Description :
From Genome Similarity Track
Location :
Scaffold_121:67839- 69264
Transcript NameFunction/comments
Sappa_CBS223.65SPRG_21266Hypothetical protein

Sequence
1425 bases(100 bases per row)
CCCAGACAAACGCCACGACGCAGAGCAGGAGCGCGATCGCGAGCTGCACGAACGAGAGCCAGCTAAACATGCGCACGTAGATCGAGACGGCGCCGATCAT
CGCAAAGATGAAGATGCCGTTGTCGAGAATGAATTCTTGCATGCGGCGCTGCTTGTGCGCCAAGTCGGTCGGACCGGACGACCGCATGAGGTACGGCCCG
AGCTGCGTCACGACCGAGTAGAGAAGGCCCTAGCAGCATTGCGTGAGCGGCGAGGCTACGCGATTCGTAGCAAGTACGTACGTCGCGTTGGATCTCGTTG
GCGTGGCTGAGATAGGCGAGCATGCGGCAGACGTTTTCCTTGGCGCCGCGCAGCGCCTGGCTGAAGAGGATGCTCCAGATGATGACGCGGAAGTAGTCTT
CGAAGAGGAGGAAGTTGAAGTAGACGAGCGCCAGCACCACGGCCGTGCTCATGTTGCCGAGGATCGTCCCGAGCGCGAACTCGATGATGTCGGGCATGCT
GCTTGCGGCAAACTGAAGAGCAACTTAGCGCATGAAATGGTCGCAACTTTAACGAAGGGGCATATTTCAATACGATTTAACGCCATTCTCCGACCATATT
TTTATTATATATCGTACTACTCATCATTGTAGAATAGACGATAATTTGAAATCCGCTATTATAATACGCGACATACCACAATATTATTATCAAGATGGTA
TCCACACGATGGCGTTTCTCATACGGATACCCCGTCCGGATGCCGTTGGGGATTTCTTTAGAAGACCTCAATAGGAAGCATACTCTCTGTACTGTCTCAC
TGTTCGCTTTCAAGGCCGCCAAGACACTCGGAAGAGCACAACGCGCGCCGCGGTATATTACACCTATGCAAATATACTCGTGAAANNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNN