Description :
From Genome Similarity Track
Location :
Scaffold_217:67779- 70819
Sequence
3040 bases(100 bases per row)
CTCAGCGGTCATTCGACTTTCGATTGTTAACCCGTCGGGTGGTCCGCATGGGACATTTGGTCCGAACTCAGTCTTGGTCGGCGCATTACTTGATCGGATG
AGTGGAATTACCATCTCATCGGGTAGCTTGACCGCCGAGTTGTACAGATCCAGACGGATCCCAGCTGGGATCATGAAGTCAGTGCCGAGAATCAAATCGA
CTCCTGCATGATGAGGCATTATCCATACTTCAAAATCGTATGCCACTTCCCAGCCGAGTGTCACCTTCACAACTGCTCTTGACGTTGTCACCATTCTATA
TTTACTTATTCCTTGTATGTCGATTCGATTATCTCGGCTGGCCAATCTCTTGAGACGCAGTTTCCTCGCGAAGTATTCACTAATCGCCGAAACATTTGCT
CCGGTATCCAATAATATCTTGGTCCTTCGGTCGTTCACTGCACCCAATACGAGAGCTCTCATTCTAACTCGGCGATCAAACGTTTGTGCTGACCACCATC
CCAGCCATTCTCCCGGAAGCAGCTTCATGATTCTGGTACGATGCACAGCCTGGTCTGACTGCCGAGTTACACTTGCAATCGCTCGGTGGTTATCATCTAA
CTCACCGAGCTCACGTTCAATTCCGTCGATTTCACACATCCAATTGCCATCCCCGCTTCTTCCCTCGGGCCGTCCTGCATCGCCTACGAACGCAAACAAG
AAGTTCGCCTCAACCGCAGGTTCAGCTGACTGTGGCAGCCCGGCATACTCCAACCCAGTCAGTGCTGGCGGGCCGCCGAGTTTAAATCACTCGGCGCGTA
AAGGTTTTGCAGGTCTTCTGGCACTTGCGACTTGTCGACAGAGTTTTTCACGAACGCAGCCAGCTTCTTATATTGACGAAACAGCTCGCACTGGCCGCCT
TCATGGACTTGTCTGCAGAATTTGCAGCGTCGTCGACAGTAGTGAGCTGAGTGCCCCATTCTTCCACAAGCTGCACAAGGTCCACGCTGTGAGTTTTCGC
GTGGTCCATCTCCACGGTTCGACTGTTCTCGCTGGTTGTACGGTCGCGGAGGTCGGTTCGCTGAGTTCCCCCAACTTCGATTCGAGCCTTTCTGGTCTCC
CGCCGAGTTCTCTCGGCGGTCCGGTGTATTTCCTTTATCATTGGAAACGCCGGCGTCTATGTAGTCGTCGTCTTCCGCTGAGTCGCGTTCTCCGGACTGG
TCCTCATCATCCCATTCGTCCTCGGAGTTGTACGGACTCGGCGGGTTCTGAATGATGAGTTCCTCCCCGTCGGAGTCAGCGTCAACGACAGTGACTCGGC
GGTCACGGTTCTCTTCCTTGCGACTGCGCTTCTCATCTCGACGTCCATCTCGGCGTTCATCTCGGCGGTTCTGATCCTTCCGCTTATCATCTCGGCCTCG
TGCGATCACGAGTCGGCCGCGTTGCTTCTTGCGCTTTTCGCCGAGGATCCGACGATTGATTATCTGTTCCACCTTACTGATGTCTTCCAACTGCAAGGGG
TACATCAAATCCATCACATCGTCATCACCACAATGTAGCAAGAAGTGTTCGACATGGTCAGCCGCGTCGGCGCCACCCTTTTCGTACTGGATCTTGGCTG
TCCGAGCATACCCGTTGAGTCGGATCAGGAAGTCGCAGATCGGTTCGTTGACTTTACGTCTCGCCGAGTAGTAACGAGTGCGGGCGGATTGGTCGAATTG
TGAGCAATAATAATCCAGGAACGCCTCGCTGAGTAGTTTCCAACGTCGCTGAGTCTTCTTCGGCAGCTGCCTGTACCAATTCTTCGCCGCGCGTCCCAAG
CATAGCGAGAAAGGTTCGCACCAAGCCCTTTGGGGCATCCTGGTGCTCTTCATCTCGTAGATGAAACGCTTGAGCCACTGGAGCGACGCGTCAGAGCGGT
AGCGCTTTCCTTCGAACTCAGCGATTTTGTCGAGTGAGGCGTGGGTTCGGACTTCTAGGTACTGCGTCGAGTCTTCTTCAGCCGCGTCAAAGCTCAAGTT
TCGGATGTAGTCCTTCACGGTTTCTTCACGGTCACCTCTCACGTCGAAGGCGTCGTCATCTTCCTCATCCACCTCGTAAGCCTCAGCCTCGTCTGCAGCG
TCATACAATTCACGGTAACGACCTACATTCCGCTGTCCACGACTCGGCGCTCGCTGAGTCGGGTTTAGCTTCATTGGTGTCAGCATGTGGGAGTCTTCGA
AGTACGGAGTCCCTTGCGTAGCGCGGAGCACTTCACGTCTCTTCGTCTCCGGGGTCTTCGGCAAAGGAATCTTGCTTGGGTCTTCGCCGAGTGGTTTGAA
CTCGGCTACTCGGCTGTACACCTTCTTCGTTCCACCAGGGGCCTTCTCCAATCCAAACGCCACTCTCAGCTTCTTCTTTCATTGCCAGAGCTCAGCTCCA
CCGCGGGTCAGACTCCAGTCGGACAGGATGAGGCTGTTTGATCGGCTGTTGCACCGATAGCCCATCGCCTTCAGCAGCAACACACTTTCTTCCACCAACT
GATTGATGTTGGCTGCACGCACCGGTTGAGTTCACTCAGGGCCCAACATCGGCCACTTCGTCTGCGCCATCGCCACAGGCGCGAGCATCATCATCCATTC
CGATCTCGTTCTCATCTCCTCGCCGAGTCGAGCCAACACTTTATTGGCGCTCGGCGTATCGGCGTTCCTCGTCGCTTTCGGAATAAGGGGCGGACGGTCC
CCTTGAGCAACGCCTTGTTCTTCTTCATCTTCTTCATCGTCCGCACCTTCATCGAGCTCGGCGGATAAGTTGCGCTCGACAGGACGTGGGGCTCCCATGC
GTCCCACCTGCAGCATCAACTTTTCCACCTCGCCAAGTAGCTCGGCGGTAGTCTTCGTTTCTCCGAGCTCAGCGGTCTCGGCCTTCTTTTCATACTCTCC
CTCACTTGCATCTCCGTTCTCGCTCTCCTGGTCTTGGCCATCCTCGTCGAACTGGACGGTTCGTCTCACCTCCATCGTCATGGCGATGAGTCGTTGATCC
GCCGGGTCCGACCCCGCGAGAGGCGATCCTCCAGCCGTCG