Description :
From Genome Similarity Track
Location :
Scaffold_10:677746- 711148
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G004531Similar to Os06g0698300: Probable protein phosphatase 2C 59 (Oryza sativa subsp. japonica)
Pytul_DAOMBR144PYU1_G004530Similar to SB62: 60S ribosomal protein L15-2 (Picea mariana)
Pytul_DAOMBR144PYU1_G004529Similar to auh: Methylglutaconyl-CoA hydratase%2C mitochondrial (Dictyostelium discoideum)
Pytul_DAOMBR144PYU1_G004528Protein of unknown function
Pytul_DAOMBR144PYU1_G004527Protein of unknown function
Pytul_DAOMBR144PYU1_G004526Similar to OsI_023634: Serine/threonine-protein kinase ATR (Oryza sativa subsp. indica)
Pytul_DAOMBR144PYU1_G004525Similar to MRPL51: 54S ribosomal protein L51%2C mitochondrial (Saccharomyces cerevisiae)
Pytul_DAOMBR144PYU1_G004524Similar to SUI1A: Protein translation factor SUI1 (Ashbya gossypii)
Pytul_DAOMBR144PYU1_G004523Similar to EML5L: Echinoderm microtubule-associated protein-like 5-like (Homo sapiens)
Pytul_DAOMBR144PYU1_G004522Similar to SRP40: Suppressor protein SRP40 (Saccharomyces cerevisiae)
Pytul_DAOMBR144PYU1_G004521candidate b-1%2C4-galactanase
Pytul_DAOMBR144PYU1_G004520candidate b-1%2C4-galactanase

Sequence
33402 bases(100 bases per row)
CCATCAACTCCTACTGCAACAACCCCACAAAGCCCACCAACTAACACCGGTGGTAATGGCCCAAACCCTCCAGCTCCACAAGCTACCCCTGCTGCGACGA
CGCTAGCTCCAACTCCAGCTACGACAACTCCAGCTCCAAAGGCTACCCCTGCTGCTACCACCCCTCAGAAGCCATCAACTCCTACTGCAACAACCCCACA
AAGCCCACCAACTAACACCGGTGGTAATGGCCCAAACCCTCCAGCTCCACAAGCTACTCCAGCGGCAACGACGCCAACAGGCGGTACTAAGGCACCATCG
CCAACTCCTGCTGCTTCGCAACCCACTCAAGTCAAGGTGCCTGGAGCTCCTGCTCCAGCTGCGACTCCAGTGAGCTCGACTACGAAGAGCACCGGGGGAG
CCGCTCCAGCGCCAACTCCAGCCGCGTCCAAGCCAAACGGCAAGGCCGATGTGCCAGGCGCTGTCCACGGGTACACTGAGAACAACAGCCCGAAGCAGGA
GATGCCTGTCGGGAAGGCTCCAGCGCCAACTCCAGCGGCATCTGCCCCAAAGACGACTGCTACTGGCGATGATGATGACCACCAACTCTGCGTTTAAGTG
GTAGTCTTTTTCCATTTTCCAAAGGGAAACTACGTTTTCTTGTGAGTGTAGATGTCTCTCGTAGTGTGTATGCATGGGTCCATGATGGGATTGTCGTAAA
AAAATGTACTTACAGTTGATCTAGAGCCGCAGTTGTTGCTTTCTCAAAGTTTCCATTTTCCTTGCAGTTGTTATTTTCTTTCTCAACGCCTTTTCATTTA
CGCAATGCGCAACATACTCGAACTTTTCCGCACTACCATCGTGCTGTAAAGCAAGCTCATATTGCTAGAAGAACACGACAACGGCTGAAATGTTATCGCA
GCTTTTACGCGCCATCGCTTCTTCTACGACGACGCGCGCGGCGCTCTCGCGCTGACTCGGCGGCAGCTTTGCGACCAAATCGACCACTTCCTGGTTGCTG
AGCTCGTCCCACACGCCATCGCATGCGAGCACGAGAAACGGGTACTCGTGCGCTGGCTCAAGCCTGTTAAACACACGCACAGCAAGCATGGAAATGACGT
CCCAAGATAATTAATCAGTCGTCGAGTGAAAAAAACGAACACGCAACATACCGGGTGACACTCGTCGTGGGTCTGGCAATGACAAACTGCTTGAGATCTC
TGTCACCAAAGCTCCTATCACATGAAGAACACGAGGAAAATATAGAGGAAGAGTCCTTTACGAGACTTCGCATGCTGTAACCATACTGAGACGTATAGAC
GCACGAACCTGGACACTGCCAGGACCCCCGAGACACGGTGCTGGACCACGAACCCTCCGTGGTTGACGATGCGCGCCATCTCATCCGGATCGTCCGCTTT
GTGGTCTTTCGTGAGCTGGACCGCGATCCCATTGCGGCAGATCACCGCACGACTGCATCAATGAAGATCGACAGCGTTAGCGAACGATAGGGTACTTATT
CTGCACACTTTTGAGCCAAGACAAAGTGGCATCTCACCTGTCGCCGACGTTGGACGTGAAGAGCGTACGCCCTTCGCCCTGCTCGAGCAGCAGTGCCGTG
ACGGCCGTGGAGCCCACTGAGCCCGAGAACGACTGGCAGCACTCGAGATCCGTGATCACGTACGCCCTACAAAGAAAAGAATTCCATTCAAGAACAAGTT
GCACAATCATAATGCAGCCACGCGCAATGATGTATATAGGACGCACCTCTCTATCCGCTGCTCGATCGTGCTCCCGTCGTCTGGGAGCTGCAGCTCCGTG
GTCAAGTTCTCATGCAGTGCGCGCTGCAAATACACGGAAACGTCTCGTCCTAGGCAGCAACAGTTTTCTGTTACTCCCCGTAATGAGGCAGATGGAGCTC
TCAAATACACCAACCTCCGTGGCCGTCGTACACGGCAAAGAACCCGTTCTGTGGGTTCAGGAGCAGCGCGTCAACGACGCGCACCGTGTCTTCCATCGTC
TTGCGGTTCTCGGGGTTCTACACAGCAGCCGCCACACACCACGCGCGCATTAGAGTGAGTGCTGCTTGCCGCAGTGAATGCGCGACTGCAGTATATACAG
CGCACCATTTCCTCATAGACGCTCACACACTGGCAGCAGTTGAAGGAACCCGCCATCTTGTTGCGCTTGTGCCACGCTCCCAACCTGTGGACGCGAGCAG
AGAATAGAGCGTTATGTACAGACAGCGTACACACGCGCGTGCTCGATTCGTGTAGGTGAATGTGAGATTATTGTTTCCCACCGTTTCCTATTAAAAAAAA
TGGGCACAGGAACCTTTTCGAAATGTATATAGAGAGAGATTTGTATAAAGACTATCAACAACCTCTTTTGTCGATTGTAAAACAAAACAAGTCAAAATGG
AGATGGAAAGAATCGTCTTCAATACTAATTGTTGTGAATATGCCATGGCGCCACGACACCAGCCAGCAAGCAAGACGCCGCTTCTTTTTTAATTACATTT
GCGTCTTATATCCGTTTAAAGCTCTACACAAATCCTACGGCGAAGCTCCGCGACAGACCTAAACGAAATACAGACGCGCTGCAGAGAAAAGCGAGCGAAC
TGACCACCAGCAGCGAGCGCGGCCCCACAAGCGCATTAAGCCATTTGCGAACCAAGGCCGACACGATGAACGAGTCACTATGGGCGTCGCGTCTAACGGT
AGCGACGGAGCGACAAGGTGTTGCGGCGCTTCCAGTTTTGGCGGTGCGACGAACCCTGGATCTTGTTGGCGCGGTGGCCACGCTTGCGGAGACCACGGCC
CTGGCGACCAGCCGACGTGAGGCCACGCTGCTGGCGGCCCTTGTGCACGGCGTTCGCGATCCAGTTGATGCGAGGGTCGCGACGGATCGTCTTGTGCGAG
TAGTCGACGAGGATCACTTCGAAGTACTTGTACGTCGCGTCCTGGTTCACCCAGTACGAGTTGAGCACGCGCAAGTTGGTGAACTTGTTGCCGGCACGCT
CCTCGGCCACCGAGCGCAGGTTGCGTTCGAACTTGAGCTGGTTGATACCGTGGTGCTTTGGCTTACCGTACACAATACCCTTCGAGTTTGGGCGCTTGCG
GCCACCGCGACGCACGGCGACACGGGCAACGACGTAGCCCTGCTTGGCCTTGTAGCCGAGACGACGAGCCTTGTCGACACGGGTTGGGCCGTTTACGCGG
TGGATCACTGGCAGCTGGCGGTACTCCCACGCACGCACACGGAGCAGGAAACGGAGCACATCCGACTGCTTTCGCTTCCACAATTCTTCCAAATACTTGT
AGGCACCCATGATTCCTGGCTTGGCTTAAAAGGCTAAATGACCAACGCAAAGGCTGCGCGCACCTCCATTCCCAATAACGCACAAGCAACTACCCCTCAC
AGCCAGCCAGCCATTCATTTTTCAGTTTTTGTACCGGTAAGGAACAAGGAACGGGAGTGAGATACCGGTATTCAAGAGCGGTGTTGTGTACTTTCGCGCA
ACCTGCTGCATCCGTACTTGGGCAATCATGCTGGACGGTATGCCGATGTTGCTACCGGTTTCTTACTTGTTTTCGTGCAACCTCACCAATCCGTACTTTG
CGTGACAACTGACAGTCACGTCTAACTTGAAGTACCTCTGTTAAGTACGAATGCCGGGCTGTCTTCTTATCATTCGTCCACGATGTGGTGCTTCTAATCA
GTCACTATGTGTCTGTGGAGCTCTTCAGTTCCAGATCGGCATTAAGAGAGAACAAAAGAGAGAGAGTGTGCGCGATGGCGATGCTCCTCGTGCGCCATGC
GAAGGCCAGCAGCAGCGTCATCACGTGCCGCACTGCGCTGAGCGCGTTGCCCCATGGCCGCGCGTTCAGCGTCATGTTGTCTGATGCGGGGGCTCCGCAG
TTCAAAGTGGAGCTTCTCGACGGCGACCACGCCGGCGTCGCGCTGTTTACGATGAACCGTCCCGACGCGCGCAATGCGCTCGGCAAGCAGATGATGGTCG
AGTTCCGCCAGGCGATGGACAAGGTCCGCTTCGACACGAACGTGCGCGTCGTGGTCCTCCAGAGCACAGTGCCAAAAGGTAGCATGCAGCGAGCAATGGG
ACAATTGCAAACAATGGCGAGAATCGTGATTGACTGACAGAAGCATGTGTATGTTTTTGTGTCAGTGTTTTGCGCGGGTGCTGATTTGAAGGAGCGCATT
AAGATGGCTCCAGAAGAGGTGCGGAGGCTACGAAAATATAGTCGATTTGCTACAGTGACTAGGAAGTAGATCCATTTGATTCTGACTCGTCTGAGTGTGT
GTACCCATATTCATCATTATCAGGCCGCAGCAACTGTCTTTGGTCTTCGAAGCGGCTTCGCCGAGCTGGAACAGCTCCCCATGCCTACGATTGCTGCCAT
TGAAGGTGCAGCTTTGGGCGGCGGTCTGGAAATGGCTCTTTCGTGCGACTTCCGCATCGCGGGAGCGAAAGCGCTTCTTGGGTGCCCAGAGACCTCGTTG
GCAATCATTCCCGGCGCGGGTGGCACCCAGCGTCTCCCACGTTTAATTGGTACGAAGCAAGTACTGCATGGCCTTATGTGCATGCTTGGCTCAGTATGAT
CAAATGCTAATGCTTTTCTCTTTGTGTATGCTGCATTTAGGTCTCTCGAAGGCAAAAGAGCTGATCTACACGAGCCGCCGTATTGGCGCTGACGCTGCCG
AAAAGATCGGTCTTGTCGACTACGCAGTGGACGAAAGCAAGGCGCTGGACAAAGCACTCGAGCTTGCGCGTGAGATTCTGCCGAACGGGCCAATCGGCGT
GCGGATGGCAAAGGAAGCGATCACCAAGGGATTCGAAGTCGACCAGGCCACGGGCATGGCGATCGAGCGCGCGTGCTACGCGCAAGTGATCCCGACGAAG
GATCGTATGGAAGGTCTGCAGGCGTTCCGAGAGAAACGCAGACCGAGCTACAAAGGAGAATAAACGACCCCACTTCTTTGCAGTTTGTCTTTATAAAACC
ATGAAAGATATACTTTTATTTTGACGTCTAGCTAGCCGGCCTTCATGGATACTTTGTGCATATTTCCTCCCTGCTATTTTTTTCTCTCGATGCTGGGTTC
ACAATTGCAGAAATCTCCCACAGCATCAGCGTCGAGACTCGCTCGTATTGGAAGACATGGGAAATGTCAGTGATTGGAATCGATCGTGCCGCAAACAGCG
GCTTTGAAGAAATTCGTCGACTCGAATCCGAACTACTGCTTGCCCCTTGTGTCTGGTGTCTGGTCTCGCTAACAGCGCACAATTGGCAAGTCACTTGATT
CGGCGTCATATCGCTCACGGGAGTGTGGTGCATACGATCGTGGCGGCACAGATGCTCTCGGAAAGAGTCAAAGCCCAGCAAAATTGTGGACATCGTGTAT
GCTGAGAACACGACTCGTCTCTCCAGTGTCACGATCGCAGTTAGTCGCGAGTTTTGAAGCATCAGCTCATGCAGAGCTGCTAAGAACGCTTCCGTTGTCT
CGTCATCGTAAAGCACATCGCTGGAAACAGAAAATGCCATGGCAACGGTTGATTAGATCATCTATCCAGGCTGAACGTGTTGTCAAAAGCATGACACAAC
TTACCTCGCGATGATAGTATCAATTGTGGGGGCTTCTTCATTATCATTATGCGTCCACTGAAAGTTACCAGGAATGCCCTCTGGTGCGGTCATGAATTTG
AATCCCCAGTCAAAGTATCGAAGCCGAAGGTTGCCCTGAGCGCAGACGATGAGTAAGCTTCACAGTAACGCACACACTTTATGGAGCTACCGCTGACCCA
TTTTATTCGTACATGGTGGTTGCGATCGACGTTTCGTTGGGTCAGCTCGAGGGCCGCGACATCCGCATCGGTTGCGTAGACCAAACGCGCAAATCGCGAC
GTCACAATCGCAGTAAACCCTACGAAGCAGCAGCAAAACACATCGTGAACAATTGGGAAACGCAGTCACCACAGATCGTTCAGGTCGTAATATCATACCA
ATACCACAACCTAGTTCCATGACTGTGTTCCCAGCGAAACGGTGCTAAATAGCACACACAATATGGGTTACGAGCACAGCAAAAAAACGAGATTGCAGCA
CTATGTAAACGCGTTGATACTCACTGGTGTGGCATACACGTACTCTGCGAGAAGCAACGCGGCGCGCCAGATCTGGCACCCTGCGGTATCCCACGACGTT
GCTGTTCGCCGCACTTCAATACGAAACGTGCACTTGGCTTCATCGTCTTCCTCTTCCTTCTCTCGTGAGACTCGTCTCCACTTCGTTGTCCGTCTCGGGA
CATCAAGATCGCCATCACTGTCTTCGCATGCGGCCATCGTCACCACTGGTTCTCTAGACTCCATCTCGCTATCGTGGGCCTCTGGTGCCGTCATTCGCAG
TGTGTAGATCGCAAAGTCACTTTGCTGCACGAACGGAACGATTGACTAGTTGGTGTGTATGATCTCGTAACGAAGGGAAAAACAAGAGAACTATGCAAGC
GTACGTCATCGCCAGGTAGTACTGTGGTATTGCTGCGACCCACTAGTGGTGGCGACGCACTCGCAGCATGCTCCGCCAGCTCAAGCTCTACCTCAGAAAG
CACGTGATGTGCATGCTCACAGTCCATTATTGTTGATCCACCTGAAAAAAAAGGTTGCAAATGATTAGTCAGAGAGCCTCTTTGATTGGCTAAAATCAAA
ACTTTTGTTTACGGTGCAAATACGCGCATTTGATTCGCTATATGTACATTTAAATTGGCAATCATTGGCCAAAAAAACTTATTTATCACCACTCATATCT
CTCGAAGCAGGAATGATTGCTACCCGGTCATCTGCGCCAGAGCGATCGGTGTCCATTCTGAAATTTGCCCCACGAACAGATCGATCTCCGTGTTCACGAT
GCTGCGCAGTGCTGTCTCCCGCGGCGTGTTCGCCGCCCAGGCCACCAAGCGCGTGACGGCCACCAAGTCGTCGCTCCCAGTGATGCGCGCGACGTTCGCG
CCGGGTACCAGGTCTCCGTTCCTCAAGTCCATGCAGGTCCACGCGTTCGCGTCGGTGCCGACCAAGGACGAAGACAAGGAAGCTGCGTCGCCAGCAAAGA
CGTTCGAAGAGCTGCTCAAGGAGAATGAAGAGCTGCGCAAGGAGGTCGCGGAGCTCAAGGAAAAGGTGAAGAACAAACCGGGCAAGTTCATGGCGGTCAT
CTCGCAGTTCGGCTTGCCGTTTGTGGCGTGGTGGACGACGCTGTACATCGGCACGGGTGTCGGTTTCTATGTCGCGTTCGACACCGGACTGATCGCCGGC
TCCGATGCGATTGATTTCATCATGTCGTTGGGACTCGACAAGTTCATTGACCCGCAGAGTCTGGACCCGAAGTACGGCAACATGGCGCTCGCTGTGGTGC
TGAACGAGTGCATCGAGCCGATTCGTTTCCCAATTGCCTTGGCGACGATCCCAACCGTAAAGCGCATGTTTTCCAAGGACAAGCCTGCTGAGGTTAAGCA
GTAAGAAGAACTACTAGAAGATGGGTAGCGCCGCAAGGCTGCGACCACGATTGCATATGTACATTGGCCATTATTGCCTGGAAAGCTCCCTGTCTTGATT
GAGTTTTGTGGAGAGGTTTCTGGAGGAAGCAGCAATTAATGACATCAATACAGAGCGTAGAATTAATCAGCCAGTAGTTAGTTACCTTGGAATCGTTTTT
CATTTTGGATGCAACTCCACGACGAACTTGCCATCAACAAGTATGGGCACGTCGCCTCAAGGCATACGTGCGTGATGCAAATGCCTACAAAAATGGCATC
CACCCAATGTACATCTGCGCGAGGTTTTCGTGGGACGTTGCTTCGTGGATCAATTTGTCGACTTGGCCTTGGACAGACAGCGGCAGCGTCTCGTTCTCGG
GCAAAATGCTGCGATGCGACGACGAGACGTGCGGTCGAATCGCGTCGCCCAAGTTGTAGATCCCGCGCAGACGATCGTCGATGGTCTTCAAGATAATCCG
GGTCTCCTCTTTGCTGCGGTCGTTCGAGATATCTGCGATGCTGCGAGTAGCAGACGGCGCTCCAGCGGCACTTTGAGTCGCTTTTCCTTTGCGGCCCCAT
TCGACCAGTGGGTCGTGAATGAACGATTCGAGCACGCTTCGCAAGGTTTCCTTGTTCCCACGTAGCAAGTGCATCGTGACTTCGCAAACGCGACGGAACA
CACCTTCGTACCCCGTGATTCCAAACGCGTCAATCATGTTGGGGGTGAGTCGGAACGGAACAATCTCAGGCTTTGCGAGTTTCAGTCCTTTGTCAAACAA
GCAGTCGAAATCCACGTGGACACACTCGCCATTCGTGCAATCAATGAGGATGTTTTCGCCATGGCGATCACCGAGGCCAATGATATGACCAACCATCGAC
CACACTGCTGCTGAGCGAGAAAACGTCAGACGAGACTCAAACCACGCTGTCGGGTCTACGAAATTGTTGCAAAACCACTGGTGGAACCTTGGCGTAAACA
CAGGCAACGACAAGACGTTGCGTCGATAATACGCCGCCATCTTGGGCACATTGTCGGCGTATTTTTTCTGCATCGTCAAGAAGCGTTCTTTGATCTCATG
CGTTAGCCGCACCGGTTGAATGAATCCACGCTCCGTCTTGTGGATCTGGCCGATCAGCTGACGCATCGCCTTTGTATTGCGCACCCACTCCATGAGCCCA
CTCTCTTCGTTCAAACACACCACTGCATACGTGCGCAATCGCAGTTTTCGCTTGCGTCCCTCGCCGTCTTTTTGTAAAAGCTTGTTGATCATCGTATTGA
ACTCCATCATCCGCGCGTCCTTGCGCAAATCGCCAGTCTTCTCGCGTTTGCAAAGGAACGGATACAAGCGACCGTCACTTCCAAGAACCTCAATCCGCTT
GGGCTTTTCCTTTGTCATCATCACATCCGCCTTGTCGCTAAATGCTTTGATATGGATTTGAGCTTGAGGAGAAAATGCGCTGTGTTGGTCGTCGCGTGGG
GCCAAGCCTGATGCAGGCAGAACCGTCGTGAGCGCAGCTTGCACAGGAACTAGAATTTTACTTCGAATTCGACTCAAACGAATGTGGATCTTCCGCTGAT
TTGCTGGGTCATGACCGGCGAGACTGATGAGCTCTTCTACCAACCGCATTCCCTCCGAGAAGCTATTTGCAATCTCTTGCTGGCCAATTGACACGAATTG
ACGCTGGATGTTTGAGATGATATCACGGGCTCGAGCGCGACGCTGGTTGTTGATAGAGCGGGAAAGCCCGAGAAGTGGCCACATCGCTTGAGTAGGATAC
GCCCCCAAAACCTTCACCATGATCTTCTTGACTCCATCCACGACGACAGGATTCGGGTGGCAAATTCGAGACGTCACTTGGGGAAAGCAAACCAGCCATT
CGTACGCAGGCAATGTATCTGCTGCATCATGAATAATTTGTGTGATATCAGTCAGAATCTGCTGCTCTGTACTTGACTGGCTGAGGCCAATTTCGATATG
TCGAAGAGTCTTGTTCGCCTTGCTCGCTTTCGCCCCCGAATTGCTTGTATACAGGAGTTCGCCGTATTCAAACCACAAAGTGAGTAGTCGAGGTAGCGAC
TGAAATACAAATTTCGTCCCATGTCGCAACGCTAGAACATAGTTCTTCATCAAGTTGATCAGATGCGAATGAAACACGGAATCCAGTAGGATTGAGCCTC
CTTCGCCCATTGATGCGGTTGCCTCCGGGTGACTGACACTAAGCAGGTACTCGTAGTACTTTGCTAAGAAGAAGTAGCCTTTTTCCCACTTCGGATCAAA
CTGGATCACAGCTTGATACCGCTCGATAACTTTTTTACCTTGCCGCTGGCCAGATTCTTGCATCCAGTTTGTAGCTAGGAGAAGATTTTTCGCGCAAAAG
TGCGGATCTTCCACGTCGAAATCTAACTTGGACGCGTCGATATCAACTGGCTCGAGAAGTTGAAGCGCTTCGTACATTCGGTCTTGGCTCACCATCAGCT
TTGCCTTCTCAAGAAGAGCGTACTGGTTATCTAGTGCTTCTGCATGCATCACCGCGCTCGATGCCGTGCGAGCGTACCCTTCTTTGCGAGCAAGCTTCGC
TTGTAGAAGCCAATAATGTGAAACTTCGTTCCGTAGATTCGCTTCCTGCAGCAGAACACGGCGCAGCGCTAGAATCGGGTCACGATACTTGAGCGATGTT
GGCATGGAATCGTAGCGCATTTCCCATGGAGATAGCTTCTTCCATATCGACGTTTTCTCGTCGTTGTCGTGTACCTCCTTCGTCGTTTGCAAGTATATAA
AGCCTTGTTCGGCTTCATGCAAAAAATGAAGCTTGTGAAGAAGTGGGTATGCGCGCTGATACGATTCCGCCGATGCAGCAGCGAGTGGTCCCATAACCTC
AAGTCGAGCGTCTTTCAGATTGCGCTGGAACGACTCAAGCTCACCATTGTGCAAGCTGTGCAGTACACGAATCATTTTGAGCTGAGAGACATCGATACCG
CGTAGTCGTGTCCCAACGCCACCACGTCCTCCAGCTACGCTGCCTCCGTTTGATGACATGAGCAGCGCGTTCTTCTTTTCTGACGACAATAAATCAGCCA
GCAGCTCCCAACGAGACAGACGCCACGTGCACTCCAACGCGTATGGGAAGAGTGTGCCCATAAATTCCGGCTCTTGTGTGACGATACCGTTGATGTGCTG
TAGAGCACTTTCAAGGCGACCCAACTGGATCAGGCAGCCGATCATACCAGAGTATAATTCAGGTTTCACCAGCTCCGGATCTGCATGAGGATCGGCAATG
AGACCGCGTGGGAGTTGACTTCTGCGCTTGCTGATCTGAGATCCCGTCGAGAAGAACGCTCTTGACGACAGCGCGGTTTGTATCTCCTGGATAGCTTGTT
CATAGCATGCCAACGCATCCTCCCACTGCGCTAGCTGCTCATGATCTACAACTTGATGCATCAATTCGGCCAAATTAAGCCCGTCCTCTCGATCTCCTAG
TCGAGGGTCTCCGCTGTCACCTTCATTATGTCTCTGTGCTTCGTACAGTCTGCGTAAAGTAGCAAGCCCTATGAGAGCATCGGGCTCATCCACACTTTTA
TACAGTTGCTGGAGATAGAAAGCATTCTTGGACACAAGAGCAAGATGAATTGGCCACATCGAGTAGCTACTGCTGGACTCCCTCCCATTTGCAGGCTTGT
AGTCTTGCTGACGCAAGTGAACTTCAAAGTATTGAATTGCGCGTGCATACGCTTCGATCCCATACGCTGCATTTGACAGCGACTCACTCGGGATATCTTT
CAGAAACTCTTCAAGATTTTCTTTTTCTTGATCGTCTAGCTCGGAGGGGATGTCGACAGACCTTGCTGACCCTGCTGTTTGACGACTTGCACTTCCACTC
AACGCCAGCCTCTTCTTTTCGCTGCTCCATACCCACTCATTTAACTCTTCAATAGTCGAGAAAATGGTTTGTGAGCATTGATGATGCCGGCTTGATTCTT
CACCGAATGACTTCTCTTCTACATGGCTGCTGGATCCTTTGCCAGACAATGTTGATCCCACCGGATGGATTCCTTCAATTGGAACCATATACTCGTCTGC
CATAATTCCTCGATCTCGATCATTCAAGACAGCCATAACCTCCCGCTTCAGTTCTCCATACAATTCTGGCTTTCCGGAGCGCAACACATTCTGCATTAGA
TAAGGAAGTAAGAACCTTGCAATCTGTGGGCACGTAGGCAATGCAGTTCGGCAAGCCAAGAAAATCTTCCGCTCTGGTGGTTGAGATAGATCGATCAGTC
GTCTGCACCACGCCAGTAGCCAGTCTTCGTACGATGTCCCGTGCTTCTCGTAATAAGTGATATCATCTAGGGCTGGATGTATATCGCCCGTTCCGTCACC
CCTGGCACCATTGCAACTCTTCGAAGAATCGCTCGACACCGAGTAATGTGTCAGCCAATACGGCTCCACAAACTGAAGCACATCTTTTCTCTCGAACCTA
CGTTTCATCCACTCGGGCATGATCGGAATATCAGTTGATTTGGGCTTCTGATAGATCGCAACGCCAGTCGACGGCAAACTCTGGCCGCTGTGCTGAGGAT
CTGCAGTCAATTCCGCTAAGAATTTCAAGAGTTCTTGAATGGCGAAGGCAACGGAATCCGTATTCTCGGGAGCAGCCCGTAGTTCTTTCACTAGCCAAGT
CTCAATCAACACGCACGCCAAATCCTTGGTAGAGTATTCAGCACGTTGCTCGGATCTATCTTTCGCCACTATTCCACCTTGGCTTGAGCCAGACTCGTAG
AGCATACTCAGAGGCATCCGGGCTGAATCAATCGCGCCAAGAGCACCCAAGCATCTCGCGCACAGTAGTTTCACAATTTCTTGACTTTCTGTTCGTGCAA
GCTGTAAAACAGATAGAATGATATCTACGATAGCTTTGTCCACGAAAAGATCGCCTTCATTTTCCAGGAGTGCTTGGAGCTCTCGCCCTCGAACAACCAA
GCATCGGAGGAGTTGTGTCAGCGCCATCTCACGAACTGCCATATCCCAATGGTTTACGTATGACGCCAAGTCCGTCAAATAGTCGCCCAATGGTTTGTGT
TCAGGGTCTCCGACGTCCGCTTCCAACACGATGTAAATTTCGTCAAGCTCGGGAATGGAGGGAAGCAACGGGATTCGTGGGAATGCTTGTTTGAGCTCGT
TACGCTTCTCAATAAATAAATATTTCAGAATATCCAGTGCCGTAGACATTGCAGAGCCAGTATTTTTACTCGCTTCATGCTTTGTCTCTTCTGGACTAGA
CATTGGTGTATCTGCTTCGGATGGCAGCATTTTCTGCAATACATCGACATTCCAGCAGTGCCGTGTGCGAACTCGGACGCTCTCTTGCAAAATCATGGCT
GGATCATACCCTATACAGGGAAGCAGACTGACGACGATCGAACAGAAGTTTGCCTCCAATGCTTTAACTGAAAGCATCCGTAAGAAGGTTGCCCAGGCGT
TCATTGCATGCTCTTGTAGTTCGCCCTCTACAAGCCCAATCTTCAAAGTTGCCATAACCTTAGGAACAAATGGGTCGACAATTCCATTGCTGCTTGCACT
TTCCGAATCGATGACAGCAGAAGATTTGAATAGACTGAATAGACGCTTGATGCTTTTGATCGCTTGAATCTTGCTTGCAGTAGAACTCGAGCTTGTACCA
CTGATTTTATTACCCAAATCTGTCATAATTGCCAGAAAATACTGGCGTGGCATCAACAAGCCGCCAGATCCCACGCTGTTATTTGCGTCATTTCCTTTGT
CTCGATTGAGGTACTGCGAGATCTCACGAAATGCCTTTTTTGCCAACTCGAATCGCGGACCACCCAGCTCCCACGACAGCAAGTTCAGTAGACGCAGCGG
AGAATGGGATATGATGTCACCGATAGTCATATTCTCTGGCAAAAACTTGAACAGGAAGTCCCACTCGGCAAGACGATTCTCGTTGTTGTCCACTTGAACT
TGATGAATTATCATTTCCTTCAGCACGTACTCGATGTGGTTGAGCAGTATATCTGCAATCGTTGTATTTCTGAAATCGTCGCCCTCGGACCCATCTTCGT
ACGCAGATCTTTCGTCGTCCGTTCCGTTAACTTCCGTGATGAACTTCTGGAGCATCGTATCATTCCGATCAACAACGTATGTCGGTAAAACATATCTGGC
ACTGGCGAGTAAAAACGCTGTCGCATCCACTGCTGAACCCATGAATGTTCGAAGGAACAATTGAATGTTACCAGATATCATCAGTTCGTCAACAAGGGGG
TAGTAGCACAACTCAGGGTACTCTACGCATAGCCTTCGCCATGAAACTTGATGATGTGCAGTGATTCGAGCAATTTGATCGTGTGCAGATACCGCACACA
GACTCAGCTTCTTAACGTGCGTCTTGCTCCAAATGGAAACCAACCGAAGCATCACCCAAATGAGTACTTCCACTTGCTCAGTACTGCCAGTATCACACGC
AAATCCGACAGCTCCAAGCAGTGGAATGACGGAAAGCAGCACTTGGACAGTCAGATTTTCTTCGGCATCTGCAAGCAAAAGGTCCATCTTCTCGATAAAG
TTAACATTGTCGTCTGATTTCACTGGGAAGATGAGCATCTGAAAGAACATCGGACGGTCCGTTAAACTTCCAAACAACTCTGAAATTGTCTGGCGGCTTG
ACGAGTCTCCAATGGTCAAGGTGCTCGTTACAATATCGCTAAAACGAGACAACAACTTGTAGTTGCTGGGGTGTAGATCACAGTGCCGCAAGACAGATGC
TAGGCATGATGCAGACTTCAGACGGATCGTTTCAGAACGGGTGATCAGATCCTCCGGTACCACTGATTCAATATGAGCTGGAATAGCGATCGTTTTGGTC
TTGGCGCCATGCTGCAGACATTGACAAAAGTTGCGTCTTGCGGTGCTTGATACTGAAGATGGCGACCCAAAAGTTTGCGCCATCATCTGTTCCTTGTTTA
TCAAATCGCCCTCGACGTCGACATAAGGAGTTGAGGTGACACAAAGTATGGAACTGACCGCCTCTAACACAAAACAAAGCAGAAAATCCGATGCACCAGC
TTGGATCTTGGACACGAACAGTTCCAGCAAACTCGTGACAACCTTGTCTGGCGATTCACAATCCCTACTCAGGAGAGCTGCAAGAAGAGGGGACATGGCA
ACTGACGCACATGCGACGCTCTGCGGATTTCGCTCATCTAGTATTGAGCGAGAAATGATTTGCCATAGTGTGGTGTCTTGCCATAACGATTCTTGAGTCA
TTTTCAGCGCTTTCGATCTCGACCACGAAAAGTGCACCAAAAATACTGCACGTAAACACAAGTTTCTTTGCTGAAATATTGTAGACACCAGATCCATCTT
GTGGATAACAGCGAATACACTGTCTTGGGACACATCGCTGTCAAAATCTTGGACTCTTGGCTTGCAGTGGTGAAGCAGCATCGAAATAAGTTGCTTCCAC
GATTCTCTATTCCACGGCCTCTCTTCACTCATCGTATCATCTTCAGCAAAATACCGCATGGACTCAATCGTCGAAAGAACACTCTTAAATGCTAGCCCAT
ACTTCCCGATGTCGAAGTCCTCGAAATGTTGAAGCATTGTGATGAGAAAGTCCACGCATTCTTCGGTAACAACTGCAGTAGATGACGTGAAGCTGTTCAT
CACCGAATCGACTCTTTGAAGCAGCACGCGGAAAATTGAGTAGCTCTCAGCTCGCATCATACTCGTAATCAAATCTCGAAACGGGGATATAATCCGCATC
GCAAGCGATAAGGCCGTGACTTCGTTGGTGCCGTTCTCAGAGCCGTAAAAGAGAAGATCCCAAACCCATCGACCCAGGTTCTCACAAACTTCTAGCTCTG
CTGAACGATGATCTCCATGAGACGCATATGCTGGTGAAGGGGGCTGTCGAGATGAGCCAACAAACGACCCTCTTCGTGTCCGTTTTCGGCTTTTGCTGCC
AACACTTCCATCTGCATTCAGCTCGAAGCTGTTCGTCACAAGAGATTTCGCCAGGAAATGCGAAAACTGAGAGAGTAAAGATCTTGAAGAGAGGATATAG
TGCACGTACGCAACTACAGCTGACTGCATGGGTCTTTCGAGCGTAGTGACGTCAACACATCCAAGGAGATCCACGAACAGGGACACTGGGGACGAAGTTG
TCGAGCGCCGCAGGTAGATTGCGACAATTTCCAAAACAAGGCTCCAAATCTTGTGGCGTTCATGGGTACTAAAATCAATCGGAATTCGGTCCGAATCCTC
CATGCGAAACATATTTCGAAAAACCCAATCACTTAGTGCTGGCCATAGCGTCTCAGTGGCAAACTTGGAGATGTGATGCTGACCATCTCGAATTCCCTTT
AGCACCGAAGCAATAGGTTCGATCAAATCAACTCCCGTAGGATCAAATGAGCCGACTTCATAAAACGTCAAAACCAACCGAACAAACTTTCTCTCTGTTG
ATGTTGTGACGTGGAACATGGCTTGAAGCAGACCATGCGTAGCTTGGGCGACTTCCAAGGTCTCTTGCTTTGACACACGAGTTTCACCGGTTACGCCTCG
AGAATCCTTCAGCAGCGCGCTATCTTTCTCCATGAAGAGCCTTGCCAACTGAAGCACTTTGTTGAACGCGGTATCGTTTGCAACCACCGCATTGCTTTCC
AGAATGAGTCGCTTGGCTAAGGTTAGCATAGATCTTCGTAGTGCGATCGAGTTGCTGTACGAGTGAACATGAATGGGTGGAAGCATTTTCTTCAGCTGCT
GCTTCCGTTCGTATATCTTGGTTTCATCAGCAACATACTCACAGCCACAAAGCATTGTTGCGCTTTTCGAACCCAGCGGACCATCTGCGTCTTGATAGAG
ATGGATGGCTGTATCAAGATACGAAGCAATACTCGCACCCGCGAAGCTAGGGTCGCCTTCACGATTCTTCAACGACTCTTCCAGCAAGAAGCAATCTTGC
AGCACTTCAACAGTATCACGGAAGAAGTGCACAAAGCCATACACGTCATTTTTCTCAAGAAACAGCGCCATTTGAAGGATCACATCCAATACGCTGTCTT
GGGCATCGCGTAGATTTTCGTTCGAGAAAAACGATACCATGTAAAACAGCATGGTCGCAAAAGTAGGATACGACGACGCTGTCGGCACTCCATTCGCGGA
TCCTTCGCGCTCTTGTTTACCATTGAGTGAGCTCATGGTAGGTCTGCCACTTCCGTCCATGAATAGCATCATCGAGTGCGGACACATCGATCCGCGCAAG
AGCAGTTCGACGATTTCGCACAAATCTCGCAGCATCGGAACTCCCACGTCTACAGAGACACTCGGGATCGGGCGCATGAGTTTCGGGAGCAGCTTCTTCA
GCTTGGAGAGCATGGTCTTGCACCGCTGGATGGCTGCGGGGGCGGTCGAGTCGTACTGCGGGTCGTCGTGCTGCCGCTGGTGAGCGCGTACGACAGCCAG
CAAGTTTGCGATGTCGTTCTTCGGGTCGGCGTCTCCATCGCTCGTGCCACTCGGCGTCGCGGAGACCGCGCTGTTTGCCGCCGGCCGAAGCGCCGAAGCG
CCCTCCGCGCGCGCACTTGGCATCTGCTTGCTTTCTCTTGTGCAAATTGGGTTTTGACTACCAGACTGACGGATGTGGGGTTGCCTTGCCACCACAGACC
ATCACTCCCGTGTTCAGCAATTGCACTGCGAACTTTGAGTCAGCCAGAGTGTGAACTTTGCACAAATGGTAGGGTAAAATTGCAAACTTTAAACGAATGC
GCACTTTGATAAAACTCGTATTTTAGTTGACAGTGCGTACTTTGGATACCGTACCTAGTCGGAAGGAAGCAGTGATGCGACGTTCGGGCTTTTCAAAGGA
TGGCGTAGAGCGCCTGCCTGCCTCCACATCGCAGCAGCATCCGCAAGACGCAACCGAGTCCGCAGCAAAGATGGCGACGAAGGGAGTATGGCAGCTGAAG
GAGGTGACGATCCGTTACTGCCAGCACGGCGGAAGCAGCCGCTACATTAGGTACGTTGATGGGGGATATGTGTGTGTGTGCTATTGTTGTTGCATGCGGT
GCGCTCCACGCGCGCCATGACGGCTCTACGTAGCTATTGATCGACTGCACCAACCACGCATTTGTATTGACAGCATGCATAATCAAATGCTTATAAACGA
TATTGTTTTGCTGTAGACAAATGCTCGGTGATGAGCGTTTCCTGAACTTCGTCAAGGAGAACCCTCAAGTGAAGTTTCAGACCGAATTGAAGGGCGCTCG
CCACCCAGTCCTCATCGGCGATTACAGTGAGTACCTAATGAAAATTTACCGCATTCGGCGCCACTGATCGTTAACACGTCCGCTGTATCTGTTATTCGCA
GTCACCAGCGACCGCAAGGTCTGCGATGTGAAGAATCAGGACATTGACGTCGTCATGATGCAGGTACGCTATGCATTGTAGAAATGCTTTATTGCATGCA
TGAATGCGATGCTGACGATTTTATACGCGCCGCTGTTTGTAGTTGGAGCGTATGAGAAACTCGAGCGGCCGAAAGATGACTGCGATGAAGAAGCCTGTGA
TCTCGAAGCGACCAACGATCCAAGGCATCTGGCAGCCAGACCTTGAGTTCCCAGACTTCAAAATCGAGCACCGTAATTAAGTGCTGAAGCAGGGAATGGC
GATGCCGTTGCGCATACCACGTTGTTTTCATGATAAAAAAAAAGAGAGATTCTGGATTCCTTTCAGACATTAGATCAATGGCTCTTGTTTGATATTGCTG
AGACCATGTGTGTTTCTCCAACTCCATACATAGTCATAAAGTTTGAGTTCGACAAGACACAAGCAATACATCATATCAAATATATTCATCCATCAGAGAA
AACAAAGAGCATGCCCGACGCTTTTGCTGCAGCCTACACTTTCTTTCCGGATCTAGTTACGGGTAAAAAAATCTCCTCTGAAAACTATTCTCCTCATCAT
TGTGCGAGCGCGAAGGGAGGCCGCAGCAACGAAAAGAGAAACAAATCCTCCATCAGCGTCATTCTGTTTTCATTGCAACCACCGCACCAAAAGAGCAGCA
AATGACTTAGAAACCGTGCAACACGAGCTGCGAGTCCGAGCAGATCTCCTGGTCGATCAAAAACTCGCGGATGTTCGTTCGCTGGTCACCCGACAACTGG
ATGATCTCGCCCAACTCTTCATCTTTCACCAACGCGCCGTTGCAGCTGAAGTTCTTCTTGAATGCTTTCAGGATGCGCTTGATGTCGAGGTCGTCGGCGA
GGCCCTGCACGGTCGTCAAACACTTGCGGCCGTTACGCTGCTGCACACGGATGTGCACCTTGCCGCCACCAATGCCCGAGTCGTCCTTGGCATCGGCGAA
CGCGTCTGTTCTCGTGGAAAATCAGCAGCACAGCACGCAGAAAAAAAGAGGCACCACCGAGGTCAGAAAGAGCTGCGCAATCCACCTACGCATACATACA
CACACAGTGAACGCTCGTATTCGCTGCACTCGCACGCACCGAAGGTCGTGAAGTTCTGGATGTCGGCCATTTTCTCAATGTGCTTTTTCGCTCAGGAAAA
GTTTAACTGGTGTGGGTCTAGGCAAGGGGGAACAGCTCATTCGCCCCTTCATTGGACAACTTTGCTTGATTTGCTTACTCTTCCTTGGTAGCTTCCAGCA
TACTCTCATGTTGCAACAAGTAGGGATTGACCTCTCCCATCGAATTTTCGAGAGCATGATTGGTTAGAAGAGAGGACTGTATTCATATGATTGGATAAAA
ATGAGACTATTGAAGTGGAGCTTGGAAAACAAAAATGCAATTCTTGCAGTATGGAGCAGGCTGCCTTCACGACGATGCATCGCAGCTTGATGCGCGCTCT
TTCGATGATGAAGACATGCATGCTCGTGTCAACAGCTATGCCGTATACGCATAGGCCACATGGATAGTGTGCTTGTGGCCCCTTTGCGTCTCGTGTTTCC
ATTTGAATGACGCATTGAGCGTCGCCAATTGGTGCGGAAGGAAACATGCTCTGGCGCCTTCGAGAGAGCATGGAGCCGGCGCATATAGAGCCACGTCACT
GCACTCTATGTTACTTTCTTTCTTCATTCATTGTCGGAAATGCATGAGCACTTACTTCATCCCTACCTGTCGATGTGGTGACTCGTCAGGATGCGCGAAA
GGGTGCCTCTAACGGTTCGTGCCTGCTAAAGATCAACGCTACATATCTAAAAGTGCTGCGGCAAAGGAGAAAGATTCATCTGACGTATCGGACATAGTAA
ATAGCAGCTACATGGGGAACACACTGCAGGCCGCGCTGAAGGACCACGACGCCTTCGCGCTCGTCGATGTGATCCTGCCGTACGACAACCTGCACATCAA
TGCGGTCGAAGCGTACTGGCGCAGCTTCTACGACGTCGCGACGTCGTTTGCGCTCACGAAAGCGCAGCTCCGCCAGATTTGCTGCCGCACTGCATGCTTC
TTGGACCCCCATGCGTCGACACAGTGCGCGATGAACTATGCCGATCACGCATTTGAGCTCTTCCTAGACCCGCAATGGCGGCAATCTCACCACCACCACC
ACCAGCAATCCCAACGATATCAGCAGCAACAACAACTACAGTCACAGCAGCACCCGTTTGTCATCGACGCACTCGAGTTCTTCTCAGCGATTGCGTTCGT
GAGTGCGAGCTCCATGGACGAGAAGATCGATCTGATCTTTGACTCGTGGGATATGTCGGAAGACGGCGCGCTCGACCTCGACGAGTTCACGATCTCGCTC
AAGTCGACGCTCGCTGGTCTCGGAAAGATCCTCAAGCCGACTTCTCAATCCGCTGCGACAAAGTATCACTTTGACGCAGTCTCCGGTATTATTGACGAAC
AGGAAGTCGATCTGCTGGCTGACCGGATTTTCCGTGAAATCGCAAACGTCCCACCGTCCTCGAGCGGTGTGAACCAGATTTCCATCACATGTGAGCAATT
TCGAGAGTACTGCACGCAAAACAAGACAGCGAAGAACCTGTTTGAGTTTTTCGACCTTGCCGATGCGAGTTTACTGGAAGAAGACGGCGAAGAAGGTGAT
AATTCGCTGTTTCTAGAAATGAACGAAGAAGCGAGATTAGTCCACAACGCACTCGCAAAAGCTCGCGTGTCAGATGAGAGTTCACCATCAACTGTTGACA
TTAGCGCAGAAGACCATGGTGACGAATTTTTGGCAGTCAAGCCGTGGAAAGGTGCAATTGTACCGCCCAGTAAGATTCCACCAACTTTGTCGAAAGCTGT
ACCACTTGTGTCGATCAAATTGGATTGGATCTTTGGCTACAGCGCCCAGGAGGGGAAAAACAACGTGCGTTACATACTCACCCACGGCGTCAACAACATG
AACAATCAGCCAGAAGAAATTGTGTATCCCGCAGCTGCGGCCTGCGTCGTGCTAAACACGAAAACGATGAGGCAGCGGCATCACCTTGCGCATACAGACG
ACGTGCTGTGCGTTTGCTTGCATCCAAAGCTTCCACTTGCAGCGAGTGGAGAAATAGGAAGGCAACCGATGCTAATTGTGTGGGATCTGGTATCGACCGA
GTCCAAGTGCATTTTGCAAGGCTTCCACCAGCGCGGCATCTTGCAGATCGCGTTCCAGACGGAAGAACTTTTGGTCTCAATCGGCGGCGACGATGTCCAT
AGTGTCGGTATCTACGAGTCCAAGGATGCGTGGAAATCCGCGACGCTGAAAATCTTCGCCAAGGGGAACAAAGCCGTTCCCTTCCATTTGGCGACGAAGC
CTGCGTCTGCAAACGAGTTTGTTGTGTGTGGGCAGAAATACATCGAGTTTTGGACGATCGAGGCCAAGGCAGTCATCAGCAAAAAAGCGCTGCTTGGGAA
GAAAGGCACACTGCAGCCTTTTTTAGTGGCCGAGTACCTTAAAGACACGTCATTGACTGTTGTTGGAACTAACGATGGGCATCTCTATCTCTTTAACGGG
CGAGATTTGTCGAGCGTCGTAAAAGCGCATAATGGAGCAGTAAATGCGCTGCACTTTGCAACTGGCGCGCTTCTCTCTGGTGGCAAAGATGGCCAAATCT
TTATTTGGGATGAGAAATTGAAACAAATTGGCGGACCGTTCTGCCTTGCTGACTCGGTGTTGCCATCCGTGATGCAGCCACAGTTCATCTCCGTGCGCAG
CTGCTGCTTTTCTCCGAATCGGAAAACGATCCTCCTTGGAACTCAGGCATCGGAGATTTATGAGATTGATGCGACAAATGGCCAGAACATTCGATCAGAT
GCGTTGATGCGAGGGCATTTCCATGGTGAGCTGTGGGGTTTAGACGTCCATCCACACAAGCAGCAATGCTGCACAGTTGGCGATGACCAGATGCTGCGAA
TCTGGGATCTCGACACAAAGAAGGAACTTCGAAGCGTGCGTTTGGATGGCCCAGGTCGAGCGTGTGCGTACTCGAGTGATGGGAAACTCGTTGCAGTGGG
GCTTGGTACTGACGGAATAGGCACAACAGGAGTCAACACGAAAGGTTCCAAACAAGGATTGTCGGCGAAGAACCAGGTGAAAGCAGGGGGCGGATTCGTT
GTGTACAGTGAGAATGATCTTACAAGGATGAAGGAGCCGTGCTACGAACCAAGGAAATGGGTGAGTGACGTGAAGTTTAGCCCCGATAATCGTGTGCTTG
CGGTAGCGAGTCACGACACGAAAGTCTACTTTTATGACGTGCTGAAAGGATTTACAAAGAAGCAAGTATTCAAGAAACACTCGAGCTACGTCACACACAT
CGATTTTTCGTCGGATGGAAACTACATGCAAAGCACTTGCGGTGCCTACGAGCTACTGTTTAGCGAGGTGAAACGGCACGACATATTACTGGCGCATCCG
CGTTTCGAGATGAACGATGGCACACTATAACATCAACGCTGGGGTGGTCTGTTCAAGGTATATGGGAAGAAGAAAGTGACGGCACAGACGTGAACGCGGT
TGACCGATCAAAGGATGGGACTCTGCTAGCGACAGGAGACGATTTCGGCAAGGTCAAAGTGTTCCGATATCCTTGTGCCCTTGAAAAGGCGTCGTCAGTC
GAGCTTCGTGGCCACGCCTCCCACGTGACTAATGTGAGGTGGTCACCACATGACCACTTCATCGTTTCAGTCGGAGGCAATGATCGTTGCGTGTTTGTGT
GGCAGCATGAGAAACCAGGCAACAAGGCTGTTGAGATCGATCCATACGAAGATGACGATTTTACGCCGCAGCATGCTGTTGGGGGCAACCAAGACGCTCG
GACAAATCGCGATAGCGATCCTCTTGAAATGGCGTCTGCGATTGATGATGTAGGTGATGAGTTTATGGCTGTGAAGCCGTGGCTCGGCGCGGTCGTTGCT
CCATCGAGTGCGAGTGAAATGAACTTGAAAAGCACATCCCCCGATGCATATCTGGAACTGGAACGAGTTCACGGGTATCAAGCTCAAAACGTGGCTAACA
ATGCTCGCTATGATAGTAATGGGAAAATCATCTACCACGGTGCGGCGCTGGGAATCATATACGACAAGAGTAAACAACGCCAGTCGTTTTTCAAGAGCCA
TGATGACGACATCATTGGGTTATGCGCGCATCCAAATGGATCCATTTTCGCAACTGCCCAAATGGGAAAGAACCCAAAAATTTACACTTGGAACTCCAGC
ACTGGAGCAGCTTTGTCGTGCCTGGAGGGTTTTCACCAGCGGTTCGTGTCTGCCATCTGCTTCTCGAGCGATGGCAAGAAACTTGGGAGTGTCGGAGGCG
ACGATGACCATTCGGTTGCAATTTACTCTTGGGAGAATGGAATTCTGACGTCGAGCGCGAAAGGAGAACGCAACAATGTCCTCGGTATGTGTTTCCACAA
CACCACTGGCGAATGGATCACGTGCGGAGCGAAGCATATCCGCTTCTGGCAAGAACAGGGAAAAAATCTCACGTCCAAGAAGGCGATCTTTGGTAAAGCG
AAGCATAAGGATGGGAAAGCACCAACGGCGTTTGAATGCGTTGTCTCATTTGGTAAACTGGTCGTGGCGGGTGCCTCGAACGGCGATCTCTACGTGTTCC
AGTCGTCAAATGATCTATCGAGGATTGTGACCGGCCATGCGTCCAATGCTTTCGCCCTTTACTCAAGTGGCAAAGATGGACACGAACTCGTTTCGGGTGG
GAAAGACTCCAAGATCATGATCTGGGACTCGGACGTGAAGCCACTGGCTACTGTGGATTTGAAACAGCAAGCGGCCGCAGTGTGGCTCTACAATTCGTCC
ATTCGGTCAGTGTGTACGAGCAACCGCTCTTCGAGAGTGTTCCTAGTCGGAACAGGAGGAAGCGACCTACTTGAAGTTGACGCAAGTAGATCTGGTATCT
CGTTCAATATCATTACTCAAGGCCACTACAACATGGAAGTCTGGGGACTCGCTTGCCACCCAAAGAAACCAGAATACTGCACAGTTGGAGATGACCAAAC
GCTTCGAGTTTGGTGTTTGAACACAAAAGTACAGCTACGCACCAAGAAGCTGGACTGTATGGCTCGTGCATGTGCTATTGATGACCGCTTGGATGTGATT
GCAGTAGGCTACGGGGGGCGAAATGCCCAGCAAATGCCGTCAAAAGCCTCGCAAACCAAGATAGGCAGCATTGTGCTTTTCCGCTACAGTGACCTGGCAA
AACTGTTCGAAGACAAACCTTCGAAGCAGTCGATCAGCGAGGTGAAATTCTCCCCGAATGGTTCTGTCCTAGCTGTTGGTTCCCACGATCACCACATCTA
CTTGTACAAAATCCACGACGTCAGCTGCAAGAAGGTGACCAAGACTGCGACGTTTGCGAAACATCAGAGCTACATCACCCATATCGACTTTTCAAGCGAC
AGTAAAATCCTTCAAAGCAACTGTGGTGCCTACGAGCTTCTCTTCAGTGATGCGACCAACGGTAGACACATCACGTCTGCCAGTAGCACGAAGGATACCC
AATGGCAGACGTGGACATGCGTACTTGGATGGCCAGTGCAGGGCATCTGGCCCCCTTGTTCTGATGGCACCGACGTGAATGCCGTCGATCGCAACTCGAA
AGGCAACCTGCTTGCGACGTCGGATGACTTTGGACTCGTCAAGCTCTATCGCTACCCATGTGTCACCAAAAACGCGAGCTCCACAGAAAATCGTGGCCAT
TCGTCTCACGTCACGAATGTTCGATGGAATGCGAATGATACTCACGTGATAAGTGTCGGAGGAAACGATCGATGCATCATGGAGTGGAAAGTTATGAATG
ACGGTGAGGAGGAAGTCTCTGGAAACCAACAGGAGGCACTTCATGAAAAGTTTAGTACTTTGAACAACCAAGACAAAAACGACGATGATGAGGATGACGA
AGACAATAACTTGATGGACGATCCCTCGGGCGATGAGTTTATGGCCGTCAAGCCATGGGTCGGAGCCATCGTTGCACCAAGCAACGCGCCGACGCCAAAC
TCCCGCGAGCCTGATCTTCAGCTCGAACTTGACTGGGTGTATGGGTATCAAACAGAGTTGTCGCACCAGAACCTCGTCTACAATGATCGCGATGAAATCG
TGTATCACACGGCAGCCGTTGGCATCATCTACGATCCGGTGACCCACTTGCAGCGCCATCATCTGTGCCATAACGATGACATTATAAGCTTTGCGATCTC
TGATTCCAAGAGGAACATTGTCGCGACCGGGGAACGAGGCAAGAAACCCGTGATTCGTCTCTGGGACGCCCACACTGGCGAACTGCGATGCGAAATGAAG
GGATTCCACATCCGCGGTGTGGTGTCGTTGGCGTTCAGCGCCGACATGAAGATGCTCGTAAGTGTTGGCGACGATGACGACCACTCAGTTGCGCTCTGGG
AAGACGCGAGCAATGGCTCGTGGACGTTAGCGAAGCTCCGTGCAACGTCGAAAGGGGATAAAGGCGTCAACCACTTTGCGTCATTTTCCAGTGCTGGTAG
CAGCAGTGCCATCGTCACTGGAGGCGCAAAACATGTCTTGTTCTGGACGATCGAGGGCAAATCCATGACTTCCAAGAAAGGCAAAGTCGGGAAGAAAGGA
GTTTTGCAGAATTTTCCCTGTGGCTGCGTGTTTGGGGACGAATTTGTGACAGGAACAGCGAGCGGTGAGTTGTACGTGTGGCGAGGTGGCGAAGTCTCCA
GGATCGTCAAAGCGCACGAAGGTGAGACAACAGTCATGTACGCTCACAGCTCGGAGAATCTTGGGATTGCAGATAGCAAAATGGCAGCAACAGGAGTGCT
GCTCAGTGGGGGCAAAGATGGCAAAGTGATGATGTGGAATGCGAATTTCCAGTCACTGAAATGCTTCGATTTAGTTGCAATGGATGCGAGATGCCTACAG
AAAGCCATTTGCAGCGCGTTCCTGAGCACGAGTGGTCAGAAACTGCTTATAGGGACCCGATCCAGCGACATCATCGAGATGGACGTGTCCTCAGGAACAC
TGCTCAATGGCGGCAAACCCTTATTTTCTGGACACTACAACTCGGAGTTATGGGGTTTAGCTGTTCATCCGAGTCGTCGAGAGTTCGTGACGACAGGTGA
CGACGGCACACTTCGCGTGTGGGATATGGAGACCAAACAGCTGACGCAGCTCACTCGACTTTCGTCGAAATCCCGAGCCTGCGCGTACTCGCCCGATGCC
ACAGTCTTTGCGATTGGTCTTGGTGGCGACAATGGGGTGCGGCACAAAGCTACTGGGAAGCAAGGTGGCCAAGCCAAGTCGAAAGAAGGCGCGATCGTGC
TCTTGAATGCGCAAACTGCAGACGCCAAAGTGCTTTTTGAAGATTCCCCGGCGAAGGAATGGATCAGCGATGTGAAGTTCTCGCCGTGTGGTCGGCTCGT
CGCGTTTGGCTCGCACGACAATGCGATCTACCTGTATGCCCTCTCAAATGGGGTGAACAGCGGCGTGCTCGATGCCAAGAAGCGCAAACCGTTTGCCAAG
CACAATAGCTACATCACACACTTCGATTTCTCCGAAGACAGCAAGTACATCCAGTCGAACTGCGGCGCGTATGAGTACCTCTTTTGCGACACCTCGACCA
GTGAGCAAGTGCGCTCGGCATCGTCCTTGAAAAACGTGGCGTGGGCCACGTGGACGTGCACGCTTGGGTGGCCCGTGCAGGGCATTTGGCCCGAGTGCGC
CGACGGCACCGACATCAACGCCGTGTGCGCGTCGTCCTCGCGCACGATCCTCGCCACAGGCGACGACTCGAGTCTCGTCAAAATATTCCGCTATCCGTGC
ACCATGAAAGGGGTACGTTGCTTGCTAAATTAGTGCTTCATGCGCATGATCTGCTTGGCTGCATGTTAACGCTTGTGTGTGTGAATGCTGCTGCTGTTGT
ATGCGTCTCAGTCCAAGTTCATTGCCGGCCGCGGGCACGCATCACACGTCACGAACGTGCGCTTTAGCTGCGACGACAAGTTTCTCATCTCGCTCGGCGG
GAACGACCGCTCGATCTTCCAGTGGAAGCTCACGTAGCCAACCAGCGAGCCTTTCCCGCATATTCAGCAGCACGCTCACTATCCAGTAAACGCGGCTTTG
GACGTCGCAAAGGCTCTGGAGTTCGTGCTCGTGCTCATTTCCATGTGGGAGCGCGAGCCAAATCCGCAGTGATGATGACAAACACAATAGCTCCCTATTG
CACTGTGGTTTTGGCTCAATTCCTGTGACTTGGCCCAACTTCAAGTTGAAGTCTTGAACACCCCCGTGCTGGACTTTTTTCAACCTTCATCACGCAACAA
CAGCGGTAATATCAAATCAGAGAGTCTTTCCAATACGACTCCGTTTGTCGTGTTTTTCCGTGGAAGAAAAGAACCAAAATCCGCAACAGACGAGCCGTCC
GTCAAACCAATTGCTGCAGGGCCAATCTGCTGCTGACGCGCGTGCGTGCCTCGAGGGTGGGACCTGCTGCGTGCAGCCAGCAGTCGTCTGCGCGCTGTGC
ACGACGGATCTTTCGCTACACATACACACAAAGATCGCGTAGCTACGTCCGTCCGTCCATCGCGCTCTTGGTGCTTGGATTTTCAGCCACCAGCCAAAAA
TTAAGTCAAAAACGGCTCGCGTCGCAGCAACTTGTTTTGCTGTTTTTTGTTGTTTTTGTATTTTTTTTGTGAGAGAGAGACTCAACTACCGACGCACCCA
CATTCTGTGTGATTAGTTTTTTTCTTTGTTTTATAGTGAGGTATACCCACACTCTGTGCGTGGCAGAGAGTGCGATTGCCCCAGACGAAAAAACGAAGGA
AAACAGACGGAACGCGAAATGCAAAACGGCACTTTGCGGGAAGCTGGCGCTGCGAGTAGGCGGCGGCATACGTTTTCCACACACTCAACAATGAGCAGCT
CCACGACCGTCGTGCTCCAGCAGCGATGCGCTGACGACGCCGCGCTGTCATCGCGCGTGCTCGGCGCCTCCTCCGCGTGCTGCACCAGTATCCCCAGTGG
TGGCGACGACGGCAGCGTTCCGTCGCATGAGCGGATCATTAGCGCCAAAGCCGCGGCGACAGCTAGGGGAGACAAGAATAGCAGCTCCTCAACTTCTTTG
TCGTCGTCTTCTCCGTCGCGCGCCATGACGGTGCTGACGGCTGTCGAGCGCTCGCTGCTGCGCACGCTGGCGTTCATTTTCTATCAGCTCGACCGCAATC
AAGCCAAGTACTGCGCGAGCTCGATCCTGCAGTGGTACTTCCAGTTGCAGACGCAGTTGCCGCTCGCGGCCGTCGACTCGCTCGAGCGCGTGGCCGAGTC
CGTGATCGCGCTCGCGGATGCAAAGTTTACGAAATTTTGGCTGTCGCTGCTAGAGAAAGAGCTCGATGACGAGACGGGTAATACCACGAATAGCGCCGTC
AAGGAGTCTCGTATTGACATTGGGAGCTACGAAGAGGATGCGTATAATGCAGTGAAGCTGCAGGCGGACGAAGAACGGCATCAGCGCGAGAAGACATTCG
TGAAGCGGCTGTACCAGCATGTCTACTTCCGCATCCAGAGTCTGTTTTCCACTGCGGGAAATGCAGCGTCAAGTAGTGACCGTGGCCACACACAGACCCC
ATGCACGTCCCCCATTGATGGATGCGACGAAAGCCACTTCCAACCACATCGAAAACGACGGAGGTACCCCACATATGCGCACCATGAGGACAGCGAGGAC
ATGGAGAGCAGCTGGAGCCCAGACAGCAGCAATCATGGACATGACATGTGTAGTGACGATGAGGAAAGCGAGGAAGAGGACATTTTCGAACCTGGATGGG
CGGTCGAGTACATGGAGCAGGAGTCGATGGTCCCGAACGAAGTCACGCGGCGCATGCACCAGATGATGCACTCGACGATCCCATTGAACTTGTTTCAAGT
CACAGTCACATACAACTCGGACCAGGCGGACGACGCAGGCGGAGGCGGCTTTGTCGGCGTCATCTCGCCTGAGTCGTTCCCGCCGACGCCGATCACGCGC
GACCTGCAGACGCAGCGGATGAATTGCTACACCGTGTCGGTGCTCGACCACGCGACGCTGGCGCTTCGGCTGCTGGAGGCTAACTGCAGCTCCTAGCACA
TGGTAAAGTGTATGGCAGTGTCTATCATTTTGCAACTGTAAATGTTTCTTTTAACGAACGCATGGAATACGAGTACAATATCAATAGGACTACAATTATA
TGTGGGGCTCTGCGGATCATGAGATGAGATGTATTTGACGCAAACGCAATAACAGCCTCTATGAAGTTTCCTTGGGGCAGAATGAGGACCAACTTCTGTC
GCCATTTGTCAGAACAGGATCAATTCGCCTCGGTCAAAAACAAAGACGCACTGCTATTCCGTCTCCCGTTTGCAATCTGACTACCGTTGCTGCCGACCAC
TATAATAGCGCTTTTGCTACCTTGCGGTCGTCGCATTACCAGCTTTTGGACGCCTGGCCTATCAGGAAGGAACCGGTGGAGGCAATAGTCTGTGCGCAAT
TGATCATCGCACAGAGCACAACAGCAGGCGGCAGGAAGCAAAACAGAGCAAGCAGTGCGACCTGCTTCTTTCACTATGGAGTCACCTGTGCACCGTCTGT
GATTGGCTGAAAACTGAGGATCTGTTTCTGTCACACACAGAACACTCTTACTTTCTTCGCTCTCACTTGAAGCGTCTCAGCTACCAGGATCTCTCGATGT
TCAACTAAAATAAATAGCGGAAGTGCCGTTGGAAGAAACGAAAACAGCCATGTCTGGTGTTGCAGTTAATGTTTAAACAAGTCTAACGACGGTGGCATGC
GCTATGTGAACGCTCGAACATTGAACACGCAAAGGTGCGGTCGAGTACCACAGTCGAGCAGGCGCAGGTGTGGTGCGATCCAAGACTGTCGGGAGTGAAG
GACGCTGGTCAGGGGCAATGCGAACTCGGATCGTCGTCAATGGCACGATCGCCATGTTGCCTGGGTCAGCATATTGGTGTGTTGTTGCACACACACACAC
ACTTGCGATAAGATGGATACAATTTGGATATTTTGTATCATACAACCAATTCGTTAAGATTGATTGCATTTGCCAGTGTACCGCAAACACTCGTTTAAAG
CAGACAAAAATAGTAGGTTATATCATTCTTAGAGGAAAACGGAATGCGTTTGGCACATGATAGATCCATGCTTGAAGTATGCGAAAGCATTGCTTCAGTG
TGCTTCGCCGGTCTTATGGATAAGATAAATCAAGTGTAGTATCCCTGTTATCAGGTTGAAGCTCGCAATTTCAACCTACTCTCGTGCACCTCCGCCCATC
CGCCACTACACACTGAAGTACCGGCCGCCAGTTGTTGCGTGTCATTCTCAAACTTGCCGAAAAGGATCAAGCAGACGACGATGCCGGGCTACAAGGCATT
CGCGACGCTCTTCGCGTGCTTCGCTCTCGCTGCGCATGCTGCCACCGCTGCGGTCATCAAAGGCCACGATTTATCGTCCATGACGTACATGGAGACGCTG
GAAGGCGTCACGTGGTACTCGGCCGCGGGCAAACAAGAGAAGCTGGAGACCATTCTCGGCGAGGGGGGCATGCAAAGCGTCCGGCTTCGGTGAGTGCTAT
TTCGTTGTGGTTTCTATCACTGGCGCTCTTTCACCTTGACAATCTCTATCTGTCTTCGTTTGCACAGAATCTGGACGCTGGACACGTATGGCCTCGACTA
CACGCTGAAGCTCGCCCAGCGGCTCTACACGGCAGGCTACAGCATCTACCTCAACATGCACTTTTCGGATACGTGGGCGGATGGCGAGCACCAACTCATT
CCGGCAGCCTGGAACTCGACCGATCTCACGGAGCTCGCCAAGGACTTGCGCACGTATGTCAAGGAGACGCTCGAGGCTTTCACGAACGGAGGCGTGCCCA
TCGAGATCCTCTCGCTGGGCAACGAAATCACGTCCGGCATGCTCTACCCGTTGGGCGAGACCAGGAACGGGAATTACACGGGCCTGGCGACGCTCTGGGC
TGCCTCGCGCGATGGCGTGAGAGACGCGGTGGCCACCGGCACGAAATGCCCCCAGATCATGATCCACTTGGACAACGGCTGGAAACTGCCGACGATCCTA
CACTTCTTCGAGGGGCTCTTTGGTACGGGTATTGTCAAGACGTCCGACGTGGATGTCTTGGGCTTCTCGTTCTACCCGTTCTACGGCACGGGGGCCACCA
TTGAAGCGCTCACGACCTCGCTCACGACGCTCGCAAATATCTACAAGAAGCCGATCCATGTGGCCGAGACCGACTACCCCAACGAGTGCCCGGGCGTCGA
GCTCAGCACCAACTTCTCCGTCAGTACGGCAGGTCAGATCGAGTGGACGCAGGCGATCATCAAAGTGCTCGAGGACCTTCCACATGGTCTGGGCGCCGGT
ATCTACTACTGGGAACCAGCGTATGTGAAAGTGGCGAGTCTGGGCAGCGCCTGCACGTCGGCCCTGCTCTTCTCAGTCGACTGGACGTATTGGCCCAACA
CCACGGCCACTGCGCTTGCATCCGTCGACCTCTTCAAGTGATATTGAGGCTCTTTTAACCTTCTGGAATTGAGGAATTGCCATCACTCTATGCGTGCTTC
ATGATGTCGACGCGAAATTTCCACAAAAGCTATAGAAAAAAAGCATGTTGAGTATTTCGTCTGTTCGACAGGATTCTCTCTGCTTAGAGCAATCATTTCT
CTCTCATGCAGTTAACAAGGGCTGCTGCAAAATGAAAGCGCGTACAGAGATGGCTCCACATAACTTATCACAATTTGAGTGAGACACCAAACTGTCTCCC
TTATGTGCACGTGTAGCATTGTGTCCACATAACGCGGTCAGATTGCGACAAACACGCGTACTGAATCGACTCGTTTATAGAGACCGCTATCAAAAGTCCA
GCAGCTGTTTTATCCCGTTTTGCTTACTCTTCGATTGATTGTAAGAGCAACGAGTGTCGTTATATTCGAAGTCGAGCACATTCCGAATGTCAAAAACCAG
CAGAAAAAATAGAGGGGACGTTCTAATCGAACGCAATCGTTCAGTAATCAGCTGATTATCCTAGTGAGCCTAATTTGCACACTGCCTACGCACCATCATG
GTGAGCTGCATGTAAAGGCCACCCGCCTTCAATCAGTCAACATCCTGAGCCCCAGATGGACGCGTCCTCGTCAAGACTGTGTCACTGCATCTTCTCCTCG
CGCCGGGCGTGCATCAAGTCATCCCAAAGGCACTGTTGACGATGCCGACTGCACCGGTTCCTGGTTCCCATGCGGTTTGCTTTGCTCACTTCGGGATTGA
CCCTCGCTTGAGCAAGTGCAGCATCTTCGACAAGGAACGATGGGACTCAAGGCGCTCTTGCTCAGCGCGTGCGTCGCGCTCGGTATGCGCACGGCCGCGG
CCTTCACCACAGGCCACGACCTGTCGTCTGCGGGCTACATGGAGAAGGACAAAGGCGTGACGTGGTACACGGCAGCGGGCAAGGCCGCGCCGCTGGAAAC
CATCCTGGGCGCCGGCGGCATGCAGAGCGTTCGACTCCGGTACGTTTGCTTGATGCTCGTCTTAGATTTGGGTTTTTGCTTGTTTAGGATCTGAACTTCC
TTGGCTTGTGTTGTTGTGTATGAACAGTTTGTGGACGGGGAGTGAGTACGGTCTCGACTACACGCTCGCGCTGGCCAAGCGGTTCTCCGCGGCCGGCTAC
AGCATCTATCTCGACATGCACTTCTCGGACACGTGGGCTGACGCCGGCGCGCAGAAGATCCCATCGTCCTGGAAGGCGTCGAATATCGAGGTGCTCGCCA
GCAGCTTGCGCACGTACGTCAAGTCGACGCTCCGATCGTTCACTGCCGCCGGGATTAAGCTCGAGATCTTGGCGCTCGGGAATGAAATCACGGGCGGTAT
GCTCTACCCTCTCGGCCGCATCCAAAACAACGACTTCAAGGGCTTTGCGAAGCTCTGGGCTGCTGCTCGCGCGGGTGTCGAAGACGCCGTGGCGGCTGGC
ACGTCGCGCCCCAAGGTCATGATCCACTTGGACAATGGCTGGAAGAAAGACACGGTCGCGTGGTTCTTCCAGAGCCTGTTCGCGACGGGCGTTGTCAAGA
AGAGCGATGTGGACGTCTTCGGTTTTTCATTCTACCCGTTCTACGACACGCGCGCCACGGTCAGCGCGCTTTCGAGCTCGCTCTGGCACATGGCGAATGC
GTACGGCAAGCCCATCTACGTGTCCGAGACCAACTACCCGACGTCGTGCACCAAGGTCAAGCTCAGCGCGAACTACCCTACGAGCGCCGCGGGCCAGATC
CAGTGGACCAAGGCGGTGATCAATGTGCTCCGTAGCCTTCCAAAGAACCTCGGCGCTGGTATTTACTACTGGGAGCCAGCGTACGTCTCGACCCCGGGGC
TT