Description :
From Genome Similarity Track
Location :
Scaffold_9:677625- 679426
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G004097heat shock protein 70

Sequence
1801 bases(100 bases per row)
TGGGTTCACAACCTTCTCCACGTCCTTCTGCTTGCCTTCAAAGTCCTCCTTGTCCGCATCCTCATTGTCGTCCAACCAGTCCATTGCGTCCTTCACAGCC
TGCAACACAATGCCCTTGTCGTCTTCCTCGATCTTGTCGGACAGCTTGTCTTCCACCGTGTTCTTGGCCGAGTACAAGTACGTCTCGAGTGAATTCTTGC
TCTCAATGCGCTCTTTCACCTTCTTGTCTTCTTCAGCGTGCTCTGCAGCGTCTTGCACCATGCGCTCAATCTCTTCCTGTGAAAGACGGCCTTTCTCCGC
TGTGATCGTGATCTTTTCCGTTTTGCCCGTGCCTTTGTCTTGCGCCGATACCTGCAAGATCCCGTTCGCATCAATCTCAAATGTGACTTCAATCTGCGGC
ACGCCGCGCGGAGCTGGTGGCAGCCCTGCGAGGTCAAACTTGCCCAGCAAACGGTTGTGCTTCACCAGCGTACGTTCGCCTTCAAAGACTTTGATCGACA
CGGCAGCTTGGTTGTCAACATGCGTCGAAAACACTTGCGACTTCTTCGTCGGGATTGCCGTATTCCGGTTGATCAACTTTGTCATCACGCCACCCACTGT
CTCAATCCCCTGCGAGAGCGGCACGACGTCGATCAACACCAGATCCTGCAGCTTTTCATCTTGATCGCCGCCCAGGATCCCGCCTTGGATTGCGGCGCCA
TACGCCACAGCCTCATCTGGGTTCACGCCACGCGACGGCTCTTTTCCGTTAAAGTAGTCCTTGATCATCTGCTGCACCTTGGGGATCCGCGTGGATCCAC
CCACGAGCACGATTTCATCGACTTGCGACTTCTTTAGACCCGCATCCTTGAGCACCTTCTCGACTGGACCGAGGGTCTTCTTAAACAGATCCTCATTGAG
CTTCTCGAACCGCGCGCGCGTCAGCGTTTCACTGAAATCTTCCCCGTTCAGCAACGACTCAATCTCAAGCCGCGCTTGGGCTTGGGTCGACAATGCGCGC
TTCACACGCTCAGCCTCGCGCCGAAGCTTCTGGAGTGCGCGCTTGTCGGTGCCAATGTCGACTCCCTTGTCTTGCTTCCACTTCTTGATGAAAAACTGCA
TGACGCGCTGGTCGAAATCTTCGCCACCCAAGTGGGTATCCCCATTCGTGGCCAGCACTTCAAACACGCCATTGTCGATTGCGAGTAGCGTCACATCAAA
CGTACCACCACCGAGATCGAACACGAGCACGTTCTTCTCGCCCTGGGCCTTCTTGTCAATACCGTAGGCGATAGCGGCCGCCGTAGGCTCGTTGATGATG
CGCTGCACGCTCAAACCGGCAATGGTACCGGCGTCCTTGGTCGCTTGGCGCTGCGCGTCGTTGAAATACGCTGGCACAGTCACGACTGCGTCTCGAACAT
CGCGACCCAGGTACGCCTCGGCGATCTGCTTCATCTTGCCCAGCACCATGGCCGAGATCTCTTCGGGCGAGAAGAGCTTCGTTTGGCCCTTGACCGTCAC
TTGGATCACTGGCTTGCCATCCTTGTTCACGATTTCGTATGGCAGCAACTTCTTGTCCGCCTGCACCGACTTGTCGTTGTAGCTGCGACCAATCAAGCGC
TTGACGTCGAAAATGGTCTTCTCTGGGTTGATCGTCGCTTGGTTCTTGGCGCCGTCGCCGATCAGACGCTCGTCGTTCGAGTCCCAGGCGACGTACGATG
GCGTGATGCGGTTCCCCTGGTCATTCGCGATGATGTCCACCTTGCCGTCCTTGAAGACCCCGACGCACGAGTACGTCGTGCCAAGATCAATGCCGATGAT
C