Description :
From Genome Similarity Track
Location :
Scaffold_645:6773- 8854
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_645-snap-gene-0.9Gene of unknown function
Pytul_var.sporangiiferummaker-pug3_contig_645-snap-gene-0.10Ecotropic viral integration site 5

Sequence
2081 bases(100 bases per row)
AGGTGAAATTGCTCGAGACGTCGACCGCACATTTCCAACAATCCCATTCTTTTCGGGCGACTCTGATGGCAAACGGCAACTTGGCAATGTATTGAAAGCG
GTTGCGCTGCATGCAACTGACATCGGCTACTGTCAGGTGCGACTAAAGCAAAGCGAACTTCGCGCCTTTGACAAAATTTTCTCTGTGCAGTTGCGCTAAC
AAAGAATTCGATGTGTGCTGCAGGGAATGAACTACGTTGCTGCAGCATTGCTGCTAATGCTACACGATCCAGATCAGGACTCAGAAGAACGAGAGCCATC
CACAACTTCAAATCCGCCTCAGGTTACGGCCTTTTGGATGTTGTGTGCGCTGATTCGCAACCACGGGATGGCCGATATCTGGCGCAGCAAGATGCCTGGG
TACGTTTTTCAAGCTTTGGCAACGTGGGAGTGTGTTGACAAGCAATGCAAACGCCTGTCTTGTTTTCTTTTTTTGAATTAGGTTGTCGCGATGTATTTAC
CTTTACAACCAACTCTTGCAGATCCACTTCAATGACTTGTACTTGCATCTGCGGCAGATTGGGATGCATCCAAGTTTTCTAGCTACACAGGTACCCTGCA
CTGCACTTCGACACAGAAATTTGTGATATCGTTCCATTCGCTTCTAACGTGCTGCATATGCTTTACCGTACGCTGCAGTGGTTCGTGACGTTGTTTGCTA
GAGTGTTTCCGCTCCCAACAGTAGCGCGCGTGTGGGATTTATTTCTGGTTGATGGCTGGAAGATGATCTTCCGCGTCGCGCTCGCTATCACAGCGCACAT
CCGTCCACATATCATCGATCTTGTACGTTGACGCTATGGAATCATTGGATGCTTTGTGTGGTAAGGTTCACCATGATTTGGTTTTGTGTGAATTGCTAGG
ATATGGAGCAATGCAGTGAATTTTTCCGGCAAAACCCGAAGCTTCAGCTGGAGCAGCTTCACATTGACGAGCTTCTCTCAAGCGCGCTGAGCTTCAAGAT
CACGCGCAAGTCGCTGCACAAGATGGAAAACGAACGGAACCTTGAGGTGGTCGAACTTTGCAGCTTTCTCTGTTATGTTGTTCAGATTCAACGCTCAATG
CCCATGTTGACGATTTACACGAATTCTAATGTTGTTAGTACCTTCGCCTCCGCCTTCAAAAGACGCCGTTGTCGTACGAGCATAGCGTGCTGTTCCCAAA
CCTGGACGATAACGGAGCTGGTCACAACCAAAAGGATACGCTCAATTTCATTCGCTCGCAACTGGAGCATTTCGACGATGATGTCACCAGCGACACGATC
GTTTTGCGGCAGAAAATAGAAGGCATTGATAAATCGTTGGTGCAGGCCACGGCGTCTCTGTACACATCGAGTTACGCACTCACGGAAGTCACGTTTGAGC
TGGAAGACCACTTGGAAGCCAAGCAGCGGCTGCGTGCCCAATTTCAAGCGCTGTCTGCGATCGCTATCGCGGAAGCAACGGCACCGTCTCCGTCTTCGCT
CTCAGGTAACGACGGCCTACGGCAGCGCAAATCTCTTCAGCTTTGGAGTCCGGCGGAAACACTGACATACATCAATAGCCGCATGTACGGATGCTTCGAA
CGCGCAACGCGATTGTCGATGCTGTCGACGCGGAACAGTAGTAAGCAAGAAGAGGATTTCGATGAGCACGAGGCGCAAGAGCGAGAGCAGGAACGACGAA
CGCTGTCACATTTAGAGATCCTTGTCCCTCGACTCGCTGCAGATTTAAAAGCTATTCAAAAGAAAATCGACGCCAATGACCTGGAGCTCCATGGCGTGCA
GCAGCGGTACCTGCGGTTGCAGAGCGAGTGCCAACTGGCCAAGGTCAGAGTGGAAGAGATGCAGCAATTTAAAGACCGTTTGTCGGACCAGATGGTGCAG
CTCATGCTCGAGACGGAGCGCTTGAAGAATTCCAAGATGCAGCAGCTCTTCGCACAGGTCGACGAAGTAAACGAGGCCCAAGAATCATGACAATTTAGGC
GGAATGGAAGCAAAGGCGCGTGGAGTGTACCTCAAACAAAAACGTTGGATTGGGTTAAAGGGAATCTAATTTATCAACTAC