Description :
From Genome Similarity Track
Location :
scaffold_4:67721- 115985
Transcript NameFunction/comments
Pl_112895hypothetical protein PHYSODRAFT_558953
Pl_112896hypothetical protein PHYSODRAFT_495212
Pl_112897hypothetical protein PHYSODRAFT_491292
Pl_112898hypothetical protein PHYSODRAFT_313216
Pl_112899hypothetical protein PHYSODRAFT_259733
Pl_112900hypothetical protein PHYSODRAFT_495691
Pl_112901hypothetical protein PHYSODRAFT_298682
Pl_112902hypothetical protein PHYSODRAFT_491102
Pl_112903hypothetical protein PHYSODRAFT_497872
Pl_112904hypothetical protein PHYSODRAFT_543923
Pl_112905hypothetical protein PHYSODRAFT_496973
Pl_112906RING-box protein 1
Pl_112907hypothetical protein PHYSODRAFT_489009
Pl_112908hypothetical protein PHYSODRAFT_313223
Pl_112909conserved hypothetical protein
Pl_112910hypothetical protein PHYSODRAFT_313225
Pl_112911myosin-like protein
Pl_112912hypothetical protein PHYSODRAFT_542020
Pl_112913hypothetical protein PHYSODRAFT_313255
Pl_112914hypothetical protein PHYSODRAFT_313256
Pl_112915hypothetical protein PHYSODRAFT_328767

Sequence
48264 bases(100 bases per row)
TATTTTTCTGATGTACTTGTCCGTGAGTTGCTTCCGTAATACACTTCAATAATGGTCGACCAAAACTAGCTAACGTTCATGCTTAGGGGAAATCGACGGG
GTCGTGCTTCAGTTGCTTCGAGTTCGTTGCTTTGCTGGTTCGATCCACTGCTGGTGCTGTGCTCTCTTACCAACCGGAGATGCTGTTAAATTTGCTTGCT
GCACACAGCTCTCTGCTCAAATCACTTATGACGCGTATACGAAGAGGCTGTTGCGAATGGATACTGCCACTTCGTTCAGCGACGGGTGCCAGCTAGTCTG
CAAGATCTTCTTGGAGAAATCCAATGCGTCGGGATCGCCATGAGCGGGCATAGCGGCAATCTGCTGCGCAAGACCACGCTGCGGCATGGAATGGCGTCGG
CTGACTCGCGCGGTACGAGGAGTGATGGAAATGTCGGCGCGTCCATAGCGGTCATAAATATGGAACTCGCTATTGTACGAGCCCGTCATGAAGTTATTGC
CGTCCCCGCTGACCGCGCACTCGAATTTGTCGAAGATGCAATCACTCTCGTACAGGTCTCCCAACCTTGGACGAAGGTGCTCATGGATCTATTCCCAAAA
CAGTGCCACCGAAATGTTTAGTTCACGAAAACTTTAATCAAAATAAACTGGATGACACTTACATTAATCGTTTGAACCGGGCGCGAGTTCATGTTAATAT
CCCACACTTTCAGCGTGAGGAAATCGCGTGCTATGATGTAGCGACCGTCAGGAGAAAACTTGATATCCGAAATAGACGCAATGATCTCGGAGAAGAAGCT
TCGAGCTTCAGGGTCTTCCTGCTCTTCAAAAACTGCAATAGAACAACATTAGATTGTAAACTTCGACGGTGTACGAGGCAAGAACGATAACCAAGACTAC
ACGAACCTTGCGAATACGAGTCACATAGAGCTGCCTGCCGCATATCACCCAGTTTAATGGCACCGCGACTCGTACTGTACATCATCGTGCTGCAATGCGT
CGGGTGGAAATCCGCTGCTGTGATGACTTCGGTGAGCTCTTCCATATTTGCAGGCTTGATATCAACAATATCTACACGAGCACAACATCATAAGAAGTCA
GCCACTGCTTCAAAGGGTCAACAGCAAACACTTACTGAAACTTTGATTGGAGATACCGAGGCTCCACAAGTTCACGCGAAGGTCGTCTGCCGACATGAAC
GTCTCTCCGTCACTATTAATTGCAATCGAGTTGATGTGGTATGTGTGTGCATTGGCGTAGACCCGCTTTGCTGTGGATGTCGTAACTTGGCCGCGGACGT
GAGTTTGTGGAAGGCGGATCAGCTCTGGAGTTACTTGAGCTCGCGGTACATGGGCGAGTCCCTGTTCATTAAACGTTGTGACTTCACGTACGCTGCGTTC
GTGAACCTTCCAGAGTTTGATCGTCTTGTCATTTGTCGACAGGAGACACTGAGATCCAGTGGATGGTCGGCACCATTTGATCTGGTTGATCTTCTCCTCG
ATCTCGAGACTTTTAAGGTAGTCAAACTCGGCATTGTGGCTCTGGAATTCAGTGTACAACTGGTACCGTGGGTCACTGGTTCCGCTGTACATCGTTTGGT
TCTGATTCCACACCAAAGATCCGTTAGAGCATCAAGTACAAGTCCTGTTCACTTTAACTAACCGATGCCGGATTGCCATGGCGATAGTAAATCGAGACGC
GTCCGCCTTTGTTTCCTGTCGCTAGAAAGTCTCCCGACCGGTCGTACTCGATAGCAGAGATGACTTCGGCTGTAGACAAATGCACTAAGCAATAACTTCT
TCAATTGAGTAGCTATCAACGACGCACCTTCCACAAAGCTGCGTGTGCTCTCTCCAGCCGAAAAGACTTGTCCCCACTCCGCATCCGCTTCGTTTGTGGG
CTCTGCCATGTTGACTTCCAGTCCTCCTGCAGCGCTGTGCTTGAGTCTAGACATCCGCGTCTCTTCTCTAATCTCCCCCTGCAGATTTGCTTGCGTCATA
CAGACACTCGACTCGGAGCTCGCACACGAAATTCTCGTCCTTGCTGCGTGTGCTGCCGCTGCCTATTCTCGCCGTCGCGGAGGATCTCGCTGTGCTTTCT
CAAAGGCCGCTGGGTGGGGGTTTCGTTTCTCACACCTGACAGACGACGCGACCACTTAGGAATGGACGGCCGCGAATTGAAGCGACGGCGCGTCTAGAGC
TGCAAATCTGCGCTCGAGTGCCGCGCTGGATGACACGCACGCACGCGCTGGGATTGACGCGAGTGCAAATGAGCTCCCGCGAGCGATCTTCAATCGGCCT
TTTGTTCCACGGATCGTTTCGACCAGTCAGAGCGAGCGAAGCCACGGCTTTTTCGCCAATCAGCAAGCTCGCTTCAAAAATCGAAGCACCGCAAGTGCAG
AAACGGGACGACTAGCTCTTCTCAAAACAGGGTATTAATACAGCACAAAAGACGACAAGAGCCTTTGTCGACAACGTACTTGTGTGGCAGTTTATTCAAG
ATTGGCGACTCGCCTTCGCTGACAAAGATCCATGCATCGCAGCATTTGGAGAAGTGCGTCGTGGTCGCATGCGGCTGTCAGCAGCGAGACCATTGGACGC
GATGGTCATTGGTTGTGATCCATGCATCGTAGCAACTCCGTTCGCGCCGTCCAGCCGATCCAAATGGAGCGATCCCGGTGATCTCAGTGCCTGGAAACGA
GTCCTGAAATCTCAACTGGCCAATACAGACCAAGTAGCATTGCAACTCACAAACCACTTCCAGTCATCATGAAGGCCACGCAACGACCAGCAGTGAAACA
ATGACGACAAGAGAGTGATCTCTGCACCGTTTCTGGGGTTCCTCTACGCAGGCGAAAGCTTGTGTGCACTGGCGTTGCAGGAAGCTGCAGGACAGACTCA
AATCTAAATGACGCTTTCCTCAAACGATCCACTGCTTCCTGGCCACCTGAGTCAATGTATCAGTGCCGCTCGTGCCTCATACTCGATGGTCGTAAATATT
CGTCCGAGCCATTGTGTCCTCTTCACAACGTCCTACAATCGTCCACGTTGGGCATTGTTACAGTACGTTCACTTCAACTTTACACTTTACAGTTTTTCAA
TGTAAATTTTACACTATAACGCAAAATTCCTATTAACACATCATTTAATATTTTGACCCACAGCCGTGAGTCGGAATGGCGCGATCGGCTTCGTCGTCTC
GTTCGAAGGCGTCTGCGGCCTCTGCTACAGCTCGCAAGCGTCGTCGTACGTCGTCCGAGTCTTCGTCCTCCGATGACGAGCAAGAGCTGGTGCGAGACAC
GCGTCGCGGCCGAGGAAAGCGTCAAAAGGCCAGCGCCATTTTAGCCGAATTTTCGAGTCTAGACGCGCTGCTGAGCAACGATCTGGCGGAGAAACGCAAG
CGCGAGAACCGCGAGCGGAAGCTGCAGAAGCTGCGCGAAGAGAGCGAGAGCGCGGAGACGGATGCGCCTCTGGGGAAGCTCATGAGCAGCATGGACACCA
ACATGTCGACGCTCTCGGGCGATAACCATTTGTTCGCGGCTGCGGAGGTGACAGTGACGGAGGAGAAGTTTGGCTACGTGTTCACACCCATGACGGAGGT
GCGTGGACTGGCTGGCGAAGCGAGATTCATTGACTAATGCTACTTGTGATGCAGCCGCTTCCGTATCGCACATACAAGGCGACGGAGATCGAGCTGAAAA
GTGACTTAAACCTCGTGTACGAGACTATGCAGTCTACAGATGATGCAGAGCTGAGTGGATTGCTGTGGTCCAAAGCAATTTTAATTCGCTGCATGCTCAA
GCGAAAGAGTGAATCGACTTCTATAGACTCGGCAATGACTCCAATTCTCTTGCCGTCGAAGATCGGATCGTGGTTATTTATGACGAGTAAGTTGCGGGAT
TACTGTTGGATGGAGGGGGTTTAAGAGCTGACAAGTGGCTTTGTAGTGTCGACACACAGCGACAGTCACGTTGTTGGAGGGTGCTTTAGCAATCTCTTTT
TGATTCTGAGTTCGGCAAAGAAGGCGTCAATTCCAAGCTTAAGCTCGGCTCTTCCTGTGGCGAGTTTCGCCCACCCCATTGAGGATTTTCGCTCAGCATT
TGGCACTGAAGTTCCTTCGATCGAGATGGAGTGGGAACCCTCCATCTACGACTTCCTCAACGCCTTCCGCGCTTACGGTTTCCAGGACAGCAAACGATCG
ATGAGCGTGAAAAGCAAGATCCCAGTCACCCCACCGTCCACAAAGAAGTCGCAGATGTTGCCATTTCCGACCCTTAATATGCACTACGTACTGATGTACT
TGGTGCTTTGTCTGCGTTCGAAGACGCTGAAGTTGGAAGGCTATGACGCATTCAGCTTCACGATGTTCTTCCTGCGGATGCAATTCGAGAACGACATCCA
TGCAAGTATTGTTGACCTGGCCACGATCTGTATTGAAGAGCTTCTGGACGTATTTCCTCGTGCTGAGTGGCGGAGGGAGTGGGCGCCACAGCTTGTTCTT
CGCATTGCTGGAGCGAACGAAGGCTTGTTTGATTCAGCTGCAGGGTGGCTTGCTGTTGCACGTCGTCTCCCTCGCACAATGCGTGGCACACAACTAACCA
CAGGATTGGCGATGTACGTTCTGCAACATCGAATCGATAAAGATTCTCAAGAAGGGGTACGTCAAATCATCATCGTCTGCGATATCACGCGTACTAATTT
TTGTGATATGTAGGCAACATCTGAGAGGCCTCTGAAGTTCCCTATCCAAAGTGGACTCGTTGTGGACATCGTCGCTGGTATTGTTGAGGACTTAACAAAC
AAGTACGCGGAGACACGCAAGACTGGCAAAGCAGCGAAGACCACGCCGCCATTTGATCTACTCTGCAAGAAGGTGGCATTGATGGACTTAGCACTGCAGG
CGTTCCTCAACATTCTTACCCCGAAGGAAATGAAAATTATGTTGGGAAAGCTTGATCAGCTGGCAGATGCCCATAAATCTACGATGTCGGCGAAGTGGCA
CGAGCTCAAGACGCTTGTAAGCCTCATGCATCGCAAGTATTCGCTTGAAAATTTGCGCATTGGCAAGAGTGCATCTTCGGCGAAAATCATGCTGTTTTGT
GACGATGATGACGATTAACAACGCCTTGACAGACGTTAACAAGGAGGGTATCTACTGAATAGAAATTAACTGAGGAGACATGGTGAAGAAATGCACAGAG
CACCAGCTGCAGTTGTCTTTTCAATTATATTGTCACTGCTGTGGTTCTTGGAACAGAGCCGCATACTGCTTTTGCAATTTGACCTCAATGAGCTGCTGTG
AGTTAACGTCGTTTGCCAGTCGTGCCATGCGGCTTTGCAGTGCGTGAGTCTCGAGACTCGACAGATTCTCGAAGCATGCCTGCTCAATCACAGCATTTTG
AAGCTCAGTCATGTGGTCGCGTAGCAATTCCAAACCTTGCTGTGTGCGGCGGTAAAATCCACCATTAACGACACGTGAACGTTCATCCAGCTTTTGCGCG
CGCTTGGAGAGGAACTGCTCAGTTTCCTTGAGTTCCGAAAAACGAGCTTGTACAGCACGAAGCTTGTCCTCAACCGACGTAGCAAACTGGAAAGACACAC
CACCGGTTTTTCCTTCCCCATCAGCCTTGCTTAAATAGCGTGCTTGCACTTCCTTCCATTTAGCACCGATAATTGAGGAGTCTTGGGACTTCCATACGTC
GTTCATACCACACAAACTGGACTCAATCTGTACCATTTGCCGCGCATGCTCCATTTCGCTGTCGGAAAATTGCTGTAAATTCGGGATTGCAACAGCGCTC
GACGATTTCTTGCGCTTTTTACTTTTTTTGGCCTTGACATCTTCCACGGGGTATTTTACTGAATCATGCTCAAGCATTCGGTACATTTCATCCGCAACCT
CATTCACTGCGCTGTGAATGAGAGCCTTCTTCACTTTTGTAGGGCGAGGAAGCCCCTTCTGTACTGCGGTAGATCGTCTCTTGAGTTCACGCTCTCGTTC
CAACTCGCGCTGATGCTGCTCACGGGCTTCTCGCTCTCCGGCGTCCTCCTCTCGAAGAGCAGTGGTGCGATCATCATCAGCTTCCTCTTTTTCAGGGACG
TTAATCTCATATTCGTTCTGTGGCGCAGGTAAACTATCGAAATCCTTGCGTAGAGTAGCTGTCACCCGTTTTGCACGAACCTTTTCCGCCTTAGCGTTCT
CAACTTCGGTGCCATAGAGCTGTTCAGGGTTAATGCCCAGTTCGTCGCGGAGAGGTGTACGCGTAGCAGACATCGGTGTCTTGTCACTGACTGCATTCGA
CACAGATGATGAGGGTGTTCGAGATGGGGTAGCCCCCGCATAACCTGTCCCTTCATACAGCTCTACATTATCACCACCTAGAAGAGGAGTGGCGCTGTTT
CGCATGGCGAGCAGATTTGCCGTTTCCTGCATAATGTTGTCATGTATATCGCGACTAGATGGCGTAGCCGTCGCACCACCATTAGCCGAGCGTAGCGGAG
TGGCGCTGTAATCTCCCATGAGAGCACGTGTCTCGGTGGCCGAGCCATTCTCCAGAGCAAGAGCGGCTGCATGAGTTGCATGCATGCCTAGCTTTGCAAG
ATCGCTCAATTCATCATTTGAAACCACAGGAGCAGGCAACTCTAGTGGAGTGCGCTTGATGGCATTGATAGGATCGTTCTTCTCATTCACCGCAGCAATA
ACCTGGGGAAGATTGGATTTCATAAGGGATTTCTGTCGCTTGGCATCCTGCTTGCGTTCCTTCTTCTCCTGTGCGTCCCGTCGTACACCTTCTAACTTGT
CCAGTTGCAGTGCTGCACGCTTGGGGTCCAGTCCTTTACTGGAAATACGTTTCTCCTCAGTGACATCATAAAACCCAGCTGGAGCTTTCTTCTCAAAAGG
AATCTCGCTCGCATAGTCGATAAATTTGCGCTTCTTCATGTGCACTCTGGGGTTAGACGACAAAACTCCAGCCGCTTTAAGCTCGCGTTTCTTCTGCAAC
GCTGCTAATCGTCGAGCTTCCTCCAATTGTTTCTCACGAGCCTTTCGTTTGGCCTTCTTACCCTTCGTATTGGCCAGACGAGCTCTAGCTTCCGACAGCA
TCTCTTTCTCATCTTCATCCATGTCCACAGGATCTGGCCTCGCAGGTTTGTTCTCCGGATTAGGGTCGATCTCACCTGGCCGTAGACGTCTCGGGTCGTC
ACTGACCTCAACGCCTTCCTTCTGTTGAGCTGCGTCTAGCAGGCGTTCATAGTGTTCCATACACTGCGCAGCTGTGCGACCCACGATGGGGGCGATCGTG
CGCCACTGCGAGGGCATGAGCTTGGCCAGATGCAGCAGCTTTTCCTCCTCCTCACGACTCCACTCGGTCTTCTTGATGCTTGGATCCAGCCATTCGTACC
ATCGCGCTTTGCACTGCTTGGCAGACTTGCGCGACAGCAGCGACGCCACACGCGCCCACTGGTTCATACCGTACTTCATCACCGCTGCCTTGAGGATCTC
ATCCTCCGTGTTCTTCCACACGCCGCCCTTGATCATGATCCGCATGGTGACAGAGGGGGCAGTACAGCTACAGAGCTAGGTGGTCGGGCTTGATGAAGGC
GTTGTCCCCCAATTAAACAGTAAACCCAAGTGGTACATAATATTGTGTTAATAAGATGTAAACTTGGTGGTCGAACGTAGTATCGTGTGTATTTGGTGTG
ACGCGTATCTTGTAACGATGCTGGTCAATTACACATGGAGCAGCGAGGTCGGACCCTTGCGGCACAGCTCCAGTTCATGGAGCGCAATGGACGCGCACTA
GAGGAGCTAGTGGCCAAGATGCTGAAGGCTCGCGAGGAGCAAGAGACGTTTCTAGGCGCATTTGCCAAGAGTCTGGAAGACATTGCGGCGCAGGAGGAAA
GCCCGCTGTTGGCGCAGTGCCTCGGGAGTCTCGGCGAGTGTGGGCAGAAGCTGGTGAGCGAGAGCCACGACGTGATGATGCTAAGACCAGAGACGGAGAT
CCTGCAGGTAGTCACGCAGATTCAGGACTGGGCTATTGTGCCTATGAAGGTGCGGGGCGGAACGAGGAGAGTAAGGGGGCTGTGCTGACTGTGAGACTGT
AGAGACTGCTGGAAGATCGGGAAAAGGCTATGAAGATTGAGGCCAAGTTGCAGAAGGAGCACGACGAACTGAAGGTCCGTGGGAGTTGATGTAACTAGGT
ATGTGATATGTAGCTCATGTGTTTATTGATGCTGGTAACAGAGAGGAAGTACTGCAAAGGAGAAGGAGAAGAAGCTGCGGATGTTGTCCGATCAAAAGCG
GCGGGTGGAGAATGTTAATACCCTGTTGGATATACATATGGAGAACTTTGACCGCTATCGTATTCAGAAGATGAAGGTGCATGGTTCGCTTGTGTTTTAT
TTGCGCGCATTCTGACAACCTATGAATCGATGCTTTCGTAGAAAATCGTAAGCGAGTTGGCTCGTTCGCAGGCGTTCTACCATGCAAAAGGGCTGGAGCT
CTTCGCCGTTCCATGCCAAGCTATTGCAAAGCTCCACTCTACAGATACGGGTAAAGGAACGCCACAATCTAATATTGCCGACGCTAGCTAGGTGCCTGTG
TCAACAATTGCCTTCCTTCGCTGAAGTCATCACCGAACTTTAGTTCAATAGATACTGCTGCATACACAGTCCGATTTACTTGCCGTCTTCCCGTTTGAAG
TATTTTGTTAGTTCCATCATAATCTTTTTCGCATGATCAAGCTACAATCCAGCTGAAGAGCGCCCTCTTTCTCGCTCTTTCCTACGTTTGCTTTGACCAA
GCTTTGCCATGCTCTCCTGTAGCTTTCGCCAGAACGATCCCTTTTCGCTTGGTGTGCGCTGTGGACTATCAGTACCGATGCCAAATTGCTGGCGCCGTGA
AATGCCTGGTGAGGCCGTCCAGCTCTGTGGCGAGTAACAATAATTTTCTAATAGCTTGTCACTGTAAAAACAGCGTTTCTGTATTGCACAAGCTCAGTTG
AGTGAGTCACAGCTCAATCCAAAAGGCATAACAAGCAGCATATGGACTCCCACCTCTTCGAATTTCTCGTAGACCAAGTGCACAGGCACATCGAGGTAAT
TCGCCAGACCAAGCTGTAAGCTGCCGTAAAGGAAGAGTACGAGTCAATTTGCAATTCATAAAGCAACTCCATGTGACTTGCAGTATGTACCTCATTTGTA
CAGGCTGAAGCGAAATCTGTCGTCGCGAGAACGTCGGAGTTGCTTGTGACACGAACGATACACCGTAGTCGGACTGAGTGAGAGTAAGCAAAAGATTGCA
CATGCTCTGTTAGAATACCTCTCATAACAAGGGGGATACGAAAACATTAGGGTTTACCTGTGGTAGCTGCGAGAATTTCACCGAGTGTTCATACATATGG
CGATATACTGCATCACTTAGAGATTCCAGCTCACTACTGTGTTCTTCACAGAGGTTAGCTCTATCAATGAACGTCGTCCACTGTACAATCACAAAAGCGT
ATTGTTAGAATGGTCGCCAGGTATGCTTCACTAACGAAAGTCTCACCTCAGCGAGGGTTTCTTCTGCTGTGTATTTGTGAATGAAAGGATGCTGCAACAG
TGTTTCTGCCGATGGTCTCACGTCTGGGTCAATTGTAAGGCACTACATACGCAAGCATAGTCAGCACACATCTCTCGCGAATCACAGCATTTAACGAACC
TGATCGATGAACGAGCGGCATTCTTCGGAATACGACTCGGGTGGTAATTTGAGGCATTGCTCATTCGCAACCTGTAAGAAAATAGACACCAAGTCATGCT
TACGTCATAGACAACAAAAAGCCGTCGATAAAACTCACTGAATCAACTAAGCCGAAGAATCCATCCTGCGTCGGAAGCGGGTAATGCCCCAACGCAACAG
ATATAAGGGCAAGTCCAAAGGACCAAATATCAGCTACAAAAGACAACCGGATCAGTTAGCCTTAGAAAGAAAACACAACACGATTTGACTCACCTGAATA
GGAATAGTCGCCACCACCTATCCGTTCAGGGGCCATGTATAGAAGGGTGCCCACAAAGGTCTTTGTCGTGGTCAAGTTGTCATTCAGAGTGCGTGCCAAA
CCAAAATCCGAAATCTTAACTTCACCCTGTCGATTCGTGAGCAGATTGTGTGGTTTGATATCGCGATGCACCATTCGCTTGTTGTGGATATGGGCTAAGC
CGTGCAATACACCGGTTGCTAATCGCGCTAGAACCTTTTCATTTTGGCAACCACCCCGCAAAACGATATCCTGCAGTGATCCCGTACACATGAATTCCAT
GACCATGCAAATAGAATTCTTGGGACGGTCAACAAAGGCATCATAGAAGGAGACGATATAGGGACTGGGTCTGCAAAGAACAAGCAAAAAAATCTCAGTC
ACAAGTTGACATTTCTGCGTAGTTGGTTGGGTCGTAACGTACTTCGGTTTTGGCTTGCTGCTGGATTTTCCGACAACAGGATGTTGAGGCATCGGGCTAT
CATTTTTTGCCATGGGTACAAGGTTTGAATACAGCGCATGAAGTTCGCGAACCATTTGCCGGCGCTGACCTCGTCCGTAAACAGGTACATCCTTTGCCAC
CCACAACACCAAAGTAAGCAGTGAAAACTAGATACAATCCAATAGGCAAAATACTGACCTTGACAGCAACCACTTTCAGTGTCGGGATATGGATAGCCTT
ATATACTACACCAGAAGCCCCACGGCCGACCTCTTTTACACGCTCAAGGTTTTCTTGCAGGTGCAGACATGCCGCATCTGGAGAAGAAATACCCGCTTCT
GATATAGCAACGTTTCTAGTGGTGAACATGCCGTGATTAGGAGAATAAGCACTCCCCGCGCTATGTCGCTCGCCTTCTACAACGAGATAATAACGATACC
ATACACCACATTAGAAAATGGTCCTACACATCCAAAATAAACAACTAGTAGACCGCACCGCTTGGAGAGTGGGGATCCGATTCGGAGCCTGAGCTGAAAT
TCAATTTCATCAACGCTTGCTGTGCAGCACTTGGTCCATTTGCGGGGGTGCTTGAACCCGATGCAGCTGCAGCTGCAATCGCAGCCGCCTCCATTGCATC
TCGCTTTGCAATATGACGACTTGCAGCTCGTTGAGCTCGTTCTTCCGCTTGCTGCGGCGTAGGCATATCTTCCAATTTAAGCCGTAATTGAGGACGCTTG
CCAACACGACTACCAGGAGTTTTTTCCGCTGATTCGACAGTTTTCCATTGCGGTGTACCACTGCGCGGGGTAGATACTGGCGGTGGTGTTCCTGCTGATG
CTGGATAATGTGTCTTTTTAGGTGGTGAAAGTGGTTGTGGACGTTTCTCTTCAAGTGATAACTGGTTTGTCAGTGAGCTGATTTCTTTGTCCACTTCCTT
TGCCGTAGAACCCACATTTTCAACCTTATTTCGGTGAAAACCATTGTTACTAGCTGGTATCGGTGCTAGTGGTGGCACATCAACACGTATATGAGAAGGC
TCAAGTGTACTGATCGTCTCTGTTGCAGTTTGTGACGATAGTTCCCCTTTTTGCGGTAAATCCAACGTTGTCTCTGACTCTGAGACCGGAAATTCTTTCT
CCATCCACGGACACTCCCACGACTTGACCTCTGCAATCCGCAACTCTCGTGGACAAATGTCCGGAAATATACGAGCGATCACTTCGTCGTCAGACTAAAC
CATTGCAAGAACACACACGTGAGTAACGAAACCTACAAACTTCGGTCCTTCCAGTCCTACCTGCTCTGTAAGATTGGGTGCCGATAAAGGTCTTGTCATT
GTGCTTTTGTGCATGAGGAACGTCGCATGGTGTGGCGCTCGTCCAGCTCGAAGCACCATGGGGGTTGTACTGGCGAAGGACGATTTATTGGACTGCAGTG
TCGTGTTGGCCGTCTCTCTGTCTCCCCCTTCGTCGTTCGTCCAGGTGTTCTGCTCGTAGCTGGCGCTCTCCACGCGACCACGTTTGCGGAATCGCTCCAT
GAGCGTCTTGCGCGAAACTTCTTGGATGGAACCGTCCAGCAGGTCCCGTCGGTGGCTGGTGGAGGAGACTGAGGAGATGGAAGATGCAGCAGATGCAGGT
GGTGATGTCTCCCGTGCCGCAGCAGGCTTGGATACGTGTCGATTCTTCTTCTTGTGCTCCTGCATGATGCTCGACCTGTGGGTGAGCTCAAGATGTGTAC
CCCCTTTGGAATCCAAACTGTTTCTAGAGAACAAGAGCAAATTGCTGATAAGATGAAAAGACAGTTACATAGCAGCTTCAACATGGTGACTACACCTCAT
TTCGGGAATAAGCATTTGCATTGGTAGAGTTGAGTAGTGGAGCGAGGAGCAGAGCGATCGAGGTCAGTAAAGCGTTAGGAATCGACTCAAAATCTTTGCA
TCCCTGTATGCACGAATGCGGAGTGATGACGATAAAATGATCACCTTAACGGGTTCTATGGTGAGACTACTGTGGCTAATTTGATGAGAACTGAGAATTC
CTAAAGTAGCAGTGAGGTCCTCCATTGCCACTGCGATGCTGCAGACCACCACTATATTTACCTGGCACTTGATGCTCACTGTGTGTGTCGAAGTCGATTT
TTTTAGATGGAAACCTCCAGAACTCGAGTCTATCTCGGGTCCACATCTTGTCTGCCTTCTGTCAGTTGTGGTCTGTTTTGGAGCTCATTCCCGATTCGGC
TCGAGCGAGGGCGCGAAGAAGAAGAGACCAAGACCAAGTATCTTCCAGTATGCGCTATCGGGAAGGACTCGCATTGCTTCTGAGCACGACAATGGGGTGG
AGCCCGGTTCTTGGAACAACCACGTGGCCAACGACTTGCTCCAGTGCAGCGGATCTGGTGTGGCAGGCCACTTGCGCCGTACGCACAGCAAATAATACCA
ACTATGTTTCGCCAACGGGAATGTCGTCCGCGCAGATCAACGTTGACGAGAATAACGCCGTGGTTGCTTATAACACAGCTCGTCAGAGTGCACTCAAGTT
GAGTGCTGTTGCGGGCAATACTGCCATGTCCGGAATGCGCAAGAAGAGCGACACCTGGTATAAGCAGTCGTTGGCTAGTTTCACCACCTACATATGCGTG
AAATCGTCGTCATCGGCCGAGTTGGAGCGTTGCGTGGACTCTTCTAGTACCGATGCTGTGCGAGACATCAACGGCAAATGTGTCGTCATGCTGGACACGG
ATTCTTGCAACAGCAAGGGGAAGTGCGAGCGCAGGAGCAACTGCAAATGGGACGACGTTGTGCCTAACGGGTCTGAAGCTCGTCGCCAGCTCTTCACAGA
CGCGGATGTCACAACTGCGACCAAGTGGATGTCGACGGGATATCCAAGCTCTTTGGCCCCTTTCGTAGCTCCCGGCACCGTCATGGGCGTACTCACCGCA
CTAGGCTGCATTGGTTTCGTGATACTTCGATGTGTCTTTAACCGGTGCGGTGGTCGTGAACCAAACGAGAAGGGCTACACGCGTTGTGATATCATAATTC
CAACGCTCACCTTCCTTGTGTGCTCGCTGGCCGTCTTTATCTGCATGGTCATCACTGCCGCACTGAACACGAACATTTCGGATGGCGTCGAAGACGTGCT
GTACTCGTTGACAGCCACACTAGAGAACGCGAACATCTTCGTGAACAACCTACTCGCTCCCTTGAACAGCGCTACCACGGAGCTTACTGTAGCATCAAAG
GCGGTGAGCTCACAGCTCAAGAGCACGGCCTGGATTGCCACGGACGGGGCTACGCTAAGAATGATGATATCGGACTTTGGGAGCATCTACTACAATCACG
GATCATTTCCGTCACTGACCTGTGATCCCGAGACAAGTGAGACGTTCTGCATTGCGTGCCCCGATAGAATTTGTGGATCCCCCATCACGTTCTTTGTCAA
CAACACGGCTGCAGCTATCACCGCTAGTAGCGATGTGGTTGGTGACGCGGTCAGCTTACTGCAAAGCTCTTTCGTGACTGGAGGCAGCGCGCTTAATTCG
AGTTTGCGCACGGCAGTACGCGATATGACGGCCTTGAGTGCGACGACCAACAGTTCCATGGACGTTGTGGACGTTCTCACCAGCACTTTCGATAGCTTGT
CTTTCTCGCGCAGTGCGCTTGTGGTTTGCGTCTTCTTTTTCGGAATGATCGCATCGATTCTGGGCATCATTGCGATTGTCAAGAATGCTTGCACTACCAA
GACGACCCACTGGGTGCACTTACTGCATGTGAGTTGGGCACTAGGTGTGCTGGTGTGTGTGCTAAGCTTCGTCTTGTCGGCGTCCCTCCTCGCTGTTGGA
GCCGTGTGGTATGATTCGTGCGAGTACATGAAGCTCTTGCACCAAGATATGTCTCCGTACGCATCAACACAGATGGCAGCGATGGCGAATGCCTGCTTCA
ACGGCAGCAACATTCTAACACCTCTGGGGCTGGACTCTCCGTTGTCGTTCTCGTGCAATATTGAAGATGAGTACAAGGTCCTTCAGGGAGCCGATACGAC
CAGTATGGCGACGATCATCTCAAGTTATGGCACTATTGTGTCGGCTTATGATCTGACCGACTTTAATTTCAACTCGACACGCTCGAGAAACCTCGTGACG
AAGCTTGCAGCTGCTGCTGAGAAAGCAAATGTCAAACCCACTGTGAAGTTCACGACTGAAAACCTCTTAACACCGTGGGTGGCATACAATCAACCGTCCA
CACTCTACAGTAAATGCACGAACTCGACCGCCGATGACCTTCCTGTGTGTTTCATGTACGAACACTGTGACTCCGGCGGTTCCGTAAGTCAGTACAAGGC
TGCTTGCCAGCTTGCTTTCAACGAAGCTTTCCAGTACACAGTTGCCTTCGACAAGGCCACGACGATGCTGGATGAAATGCGCGAGACGCTTCTTGGCGAC
ACAGGCAAGAACTTCCCTGACCAATGGAATTACTCCGTCTCCATCAGCGAGTTCGCCACCAATTACTTCACAAAGATTACTGCTCTGAAGACTGGTACGT
TATCCACCATGCTAGGGAACAACGGAGTCGTGCGTAACTTGCTGACATCGATAGAGCAAACTCGTTGCTCTGGAGACTGCGCATGGACGAATTTGTCCTT
CGACGCCATCAACGAGTCACTCTGCAACAACGTACTCGGAACGACACTGGCCATCGCGTTATGTGCGCTGTTCCTGAGTCTGTTTCTCCTGCCGCTAATC
ATTTCGGCCATCATCTTGCAGAAACGGCTCCGAGGTGTGGCTAAAGGCACGTACGACCAGCTGGAGGCGCGTCTACAGGAACTGGAGCGTCGCGCCAAGC
AGCAGAAAGCAGAGAGTGAAGGTCTCGCACCTGGTGGCGAGAGTTCCAAGCCTGCAGGCGGCCTCAGTGCTCTCGGAGGCCTCTTCAAGGGCAAGAAGGT
GCAGTCGCCAAGCACTTAACTGCATATCCTAGACCAAAGCACTTCAACTTGATTATAATTGGTCAAATACAACAACGCATTAGCCAATCAACGACGTTTC
GTATCCATGTTGAACTGCTGCATTTCTACCAACCAAATGAGTTCATTCCTCAAAGTGACGACACCATGGCAGCACGCGACGTCGTTGTGCTGGGCGGCGG
CATCTCCGGCCTTACACTTGCTTATTTCCTGCGTCAGGCGCTGCCCAAGGCCGTGGCCGATGCCACACGCATCCGTGTACTGGACGCCAGCGCTGTGTCG
GGTGGATGGGTGCATACAGCCAAGCGCGAGGGATTTCTGTTCGAAGAGGGACCAAGAGGCTTCCGTCCGTCGCGTAATGGCGCTGAGATGCTGCGTCTAG
TGGAGCAACTGGAGCTCCAGGATCAGATGCAAGCTGTGGACCCGGCGGCTCAGGCGCGCTACATCCTGCGCAGTGGAAAGGTGGAGAAGCTGCCTACGTC
GCTGCTGGAAGTGCTGCGCTGGCCACTGTCGCTCGAGGTGGCGCGCGCAGGACTACACGAACTGTTCGTCAAGCCAGGGACGATGGAAGACGAGTCGGTG
TACAAATTTATCGCCAGGAGGTTCAGTCCCTTGGTGGCTGAGAGGCTGCTGGATCCCTTGGCTTCGGGTATCTTTGGTGGAGACATCAGGAAGCTCTCTA
TGCGGGCGTGTTTCCCGATGTTGGTAGATTTGGAGAGGAAACACGGGTCTGTGGTCAAAGGGATGTTGTTCGGAGGCTCTAGTGGAGATGACATGCTGGA
TGGCACCTCCAAGTCGGACTTTATCAAGAAACACGAAAAATCTGTCAGTGTAAGCTTTACAGACGGCATGAGCACGCTGATGGATGCCCTGGCAAACAAT
ATCAAGAACGACCCGATGGCGGATCTTCAGTTGAACACGAAAGTGACGAGACTGGAAGTTCATGGACACAATAATACATCGTCTAAAGGACCGATTTTCG
TCGTAGAGAGCAAGGATCCAAAGACTGGAGAGATCCGGGAGCCTATTAAGGCCTCGCACGTGTTTTCAACCATCCCGGCATGTTATCTAGCACCGGCAGT
GAAAGACACAGCACCTGGCTTGGCTGAAGCTCTGAATGAAATCAAGTTTGTGGACATGGGAATGGTACATGTCGGATACAACGATAAGGTGCTAACTACC
GATGGCTTCGGCTACCTGATCCCTACTGCAGAGCGTGAGAAGGTACTTGGCGTCGTGTTTGACTCGAATACTTTCCCCGCTCAGAATGCAGAGGGTAAAA
TGCAGACGCGATTGAGCGTCATGAGCGGTGGTGCACACTTCCGTGAGGTCTCATCGTTGCCCACAGGCGAACTGGAGCGCAATGCCCTAGACGCCCTGAA
GCGACATCTCGGTATCACACGCCAACCAGACTACGTGCGCGCAATGACCATGAAGAATGGAATCCCTCAATATCATATGGGCTTTGGGCAGACGCTACAG
CGTATTGAGAAGCAGGTTGCTCGCAGCGCACCAGGTTTGTTCCTGGGAGGCAACAGCTTCTACGGTATTGGGCTGGCTGACTGCGTGACCCACTCCAAGC
AGCTCGCGCTCAAGTTTGCCAAGACTGTATCGTCTTAGAACAACAGCGCCAGGTTAGTGCATTCGCCGTTTTGGTCCGCTGAGGTATCCCTGAAAATGTA
CATGATGTTGCCGTTCTTGTGCTGAGTTCTAGCTTGCTATTTAAGCTAGACAGGTGTGTTGTGCAGCATCGCCGTGAAACGGTTTTGTTGTGTCTTCATC
ATGCTCTCAATGTAAAACAAGCGACCGGTCGGTCTTTTAGTGAGGTGTAGGCACTTTCATCGCGTGCAGATAATATGTCACGGACGGTGCCATCCCGAGC
ACTTGATCCTGTCTATGGTAGGCTCGTTGTCTTCGCTTCGTTCACTTCGAGATGTTGCTAACCATGATTCATTTCTGCTTCGTCCTTTGCAGACACGGTG
TACACAGTCTCAAATTCAGGGGGCTCGTTTCGCAAGGGTGTCTACCGAGCTTCCTCAAAACCTGTAAGTACAAGCAGCGCCGTCAACAACCAGAACCCGG
CGGAGGGCAGCCATCTCGTCAGCGGCAATCAGCGTGTCAAATTTCATCGGAGACCTGTGCTTCCACATCTTGAAGCAGAGCCACCAGAAGTCTTGCTAGC
TCCGGTATATGCTGCTCTAACATCGCCAGTAAAGCACCATGGCGCAAAAGTATTGACATCCTCCTACGTTGCTGCTGAAGAAGTTGATGGAGGCACGCGG
TCGGTGGGTATCCAAACAGCTTATCGCGACTCAGAGGCACAGACAGACCCGTACACACCAGACTACACCGTCCAGAAGACAGCGACGGGTGTTTCACCCG
AGGTCGCAACACTGACTGGGCTAAGCCATGCTCGTGGACAGCTACCAGTAGGCCACGCTGAGCTCGAACTCATCGAGCGCAATCGCAAGAAACGCGCGTT
CGAGGCGTCATTGCCACCAATGACCGACGAAGCTAGCTTCCTGCTCCGCAAGGCCATGCTGGAAGCGCAGGAAACTCGGGAGTGGGCATATCGCGAAGCT
GAAATCGACGCGTTCCATGCGCAACGTGTAACCCTACTTGAACAAGCACTTGCTGAACGCGAGAAGGAGAACGCATTTCTATCAGAGCAACGACTTGAAG
CTCTTCGTCAGCGGCTGCTTCATGAAAAAGAAAATGCACTTGAGGCTATTCAACAAGAGCGTGTGGCAGCATTGCGGAAACTAACCAAGAAACGTGCTCA
GAGGCAACACGAGCGCGGATTTGGTGCATCAAAACCTGAGCGAGGGCGTGACATCATTGCAGAGTACGCCAACTTTGGTTCACAAGTGTATGCTCCTGTC
ACACGCGATGGGAAAGCTGGTAAAATCGAGGTTCGTGAATCGGGTATTGGTAAGCCGCAGTTCATGCAACTTGAAGCTTTGCGCGAACTGGAGAGTGCAT
TACCTGCACGAATGTTACTGCCTGCTGCAGGCAAATATAAGCCTCGTGAGAAGGGTGGCCACACTGCGAAAGAGAGGAAGCAAGCGGCTATAAAGGCTCA
CCTCCTCAAGATGGAATCAATCATCAGGAAGAGTAAGGAGCAGAATGAGAGCATTGGTGCCACAAAGCCTGTAACTCTGGGCCAGACTCATCTGAATGCT
ACTAGTCCTACTTCACGAAGGACTAGTCAGAAGCAGCAACAGCTTGTACGCCCACCCACACCCGACTACGCGCTTATCGGCGTCGCTGATGCGCAAGAGC
ACGAAGTTGAAGATGCAGTGCGCTTACTGCAGAAACTACTGCGTGGTCGTGCTGTTCAAAATATGATGTTCGAGGGCAAGGAGAGACGTGCTGAGCTTAT
TGCAGAGCTACGTGCAGCGGACGAACAACTTGCACTGCAACGTCGTCATGAGTTTGAACTCCTGCAAGGATCTGGTACCGAGGCTATTGATCGTGTGGCA
AAAGCAGCAAAAACCCGAGTGGAAGGCGAAGTAGTCTCCGAGATGTTCGATTTCTTGTCCAAAGAGCTCTCTCGATCACGTGAAGTGGCTAAGATGCGTG
CTTTCGTGATTAAGGCGGCTGAGGAGCGGCGCGTGCGCGAAGTAGAAGAAGGAGGGCGACGGCAAGCTGAAGATCTGTTGCGTGAGCGCGAGGATGAGGT
GTTCCGACGTGTGATGCAAGTACACCAGGAGACATCTCGCGACTTCGTAGACGATGTGCTTGAAGAGATAGCTCTCGAACAATCTCATGCCCAAGCGCTG
CAAGAGCTTCATGTGCGAAGCGCTGGTGTGGATGGAATTGTGCTGCAGCTTGAAGATGAAATGGATAGCGATGAAACCGTGGTGCGCGAGCTTGTGGCAA
GCTTCTTGTTGCCACATGTACGACGGCAAAATGTATGTCGCCAAGTTGCGCAGGAGCAGAGGAAATTTGTGGCGGCGGCACATGCTCTTCTCACTGAAAT
GGCTGCAAGCATGAGTCAACCGAAGCCAGATACAAGTACGGAAGATACAACAGCTGAATAACTACACCTGCCATGTAAGGTGGCTCATCAATATCAAACT
TACAGATACAAGTACGGAAGATACAACATAGCTGAATAACTACACCTGCCGTGTAAGGTGGCTCATCAATATCAAACTTTTGTTTCCAAGGTTGTGTCGA
CACTGCTTGGTGCGTACATTATTATTTGCTTGCACCTGCAGACACGCCAGTGGTGCCACCACCAGCAGACTTGAGGAATGCGTCAAGGTGCTGTCCTTGA
TACTTAAGAAAGTCTAGCTCTTCTTTGAACTTTTTCTCCTGTAGAGCCTTGCGCTCGGCTGCTCGTTTCTCAATGACCTCAAGCTTGTTTGTGAGTTCGG
CCACTTTGCTCTCACTCTCCTCCTTGTCACGTTGAAGACTGGCGATCTGTTCTGCCAAGTCGCTCATTCCATCTTCAGCCTGTAGTTGTTTCCGCACACC
GAAGGTCAGACTGGAGTCGTAGAGTGTTTTGTAGGCATCCGTCGTGAGTCGAAGTTCATCTCGCACTCGTAGAAGTAGCAATCCTCTTTCAGGGCAGTTA
AGTGTCACCTCACGAATGAGCTCATCGAAAGCTTGCGAGTACAGATCCTCTCGAACAGGACAAATGCCACTTTCACGAGCCTGTCGTTGCAGCAGCTTGC
CATCAAGAGCTTCTTGCAATTTCAGCACATCGAAGCGAGTCGAGGGCACACTCGACGCGTACCGAAGCCAGAAGCCGGAATTTTCTTCAGACCACATTCT
GCAAACTAAGTTAGTGTTGTCAACAGTGAGTAGGAAGATCAAGTAGTGACGTACTGAGGAGGTAAGACAGCATTTAAGATATCTTCTACTCGTGCAACAC
CGTCAGAGCTCTTGCCGTTGGATGTTGATCCAGGTTCTGCTGCAGCCACGACAGTCGCTGCAGTGATGGAGTTCGAAGAAGAACCTGCATTGGTAACACC
CGGGGCCTTCTTCGGTGTGTCTAGAGTTTCGCCCGTGAAGATCGGATCACCATACTGCACTAGTGACTCAGGAGGAGTTGGAGTCGCCATCTTGGTAAAT
GCTTAAGTGCGTCGGCTAGCAACCGTCGCATCCGTTTTCAACATCAAGACATGCGATTCATATTTATTGTTTCTTGTCTACTATCTAGTGACGTTGGTTT
GATTGTGCAGCTACGAGTTGCTGCTTTTCCTGGCGCTTACGCTCCGAGAGCTCTTTCGATAATTGTTCTGGACTCTTGTAATTGTCCATATCACCGATTT
TGTGTCGCCACTTTTCGCTGTTGCTCTGTCGAGCTGCTTCCAGTGCTATGAACTGCAGAACCAGCATTAATTATCAACGCTCTTGATATCTTGCACCAAT
ATCAAGTAGATTCACGTACGTGGTCCTTGCGAACAGATTGTGTCAGCTCAACTGACTGGTTCCAAGGCTTAGCATCGTACAGGTCTGGATGGTTGGGCAG
CTCTTCCGTGCATTTGGCGATTCCCTGTAACACCAGTGTTCGTGAAGGTGTCAAACAACGGATGACAACCAGTGATAAACGTACTTTCATCACGCGCTCA
TCTCCGAAGGCATCACCTTCATATTCGTCTTTTAGAGCTACTTCCAGAATGCCTGTGTTAAAGCGGTTGGATTTGGTTTTCAGTGTCGGGTTCTTCGTGG
GTAGCTTCTCAGCTCGGAAGTTGTACCCGAACATTTGTGCACGATTTCGCTGCAGAAAATCATCGAGGAGATACAAACACATAGGATTAGCCAAGACATC
GCTCAAATTATAAAGCAACCACAGTACCTCAGCGTTGATATTGGTTCTTTTGTAGCACTTGCCATTCATCTGCATGTTGTTCCAGTTCGAAGTTGATTGA
TCCCATTGTGGTTTCTCTGAAGACAGTATGCGCGATCGAAGTGTTTCCACGACCTCCAATTTCGCTGCTGTCTTGTCAGGAGCAGTGTCACCAGGCCCAA
ATACTCGTTCCTCGAATGAATAGGTGACTGGTGAACCTTTGCCACCGATGCACTTTTTCGGGTGCAGGAAGGTCGTCGCTGGAGTAATCGATATATTGCC
AGTCGTGGCCTTCATCGTCATGTACTTTGCTTCACTTGACCGCTTTCGTACGCAAAGATAATTGGCATAATAAACAACTGCATCGTCGAAAATATAGGTG
CCACAGAGAAGCAGGGATCTATTACCGTCGACAAGGCTTGGATCAAGCTCCTATATTTGGTCCATGGGCATCTTCGCTTTGCCAGACTTTACGTCTCAGG
CAGATTCGGTAGCAGCGGAGGCAGCGGTTTGGACTTGCTGAGCTTGTCGAACACTGTTGCGTTCAGCTTGGAGGTGGCGACACAAACTCTCTAGCTTTTT
TACCTTCTCCTGCAGCTTTAACGTCTCCTCAGCTGCTGTCACCTTGTCTTGAATAGAAGCAATTGCACCGCTGTCGTACTCGGCGCACTTTTTCTTCAAA
GCAAAATTCTCCTTCTCTAGCTTCTTGGTTGTTTTCGCCATTTTGTCCATCTCTTCACGAAAGGTAGTAAACATTTGATTGCTCTTGGTGAGAGTTTCTT
GCACCACGTCGAACTTTTCAGAGTACGAGTTAAGCTGTGTTTGCAACTGAATCTCGCGATCGGAAAACTCCTTTGCCTTATCAAGAGTGATCTTCACTTT
TTCCGCCTCACGTGAGGTGAGTTCTACCTGGTGTTTCAGCTTCGTTTCCGCAAGCTGCACCGTGAGATCTTTCGCCTCCAGCTGTCGCTGGAAGTGCTCT
TCACGCGCCGTGTATTGCTCAAGAAATGCCTTAAGTTTGTGCTGGAGGCTGTAAACAGTGTAGACAAGTGAATTTGGGGTCTTTCTTGATGCCAATAAGC
GTTGTAACGTACTTTTCGTTCTCTTTCAAAGAAGCCACGTAGTCTTGGCCCTGCTTATCCATTTTCGCACTCACTTCTTCGATCGTCTTCTGAAATTGGG
CTGACAGATCTCGTCTGAACAGCACATGTCAAACAATATCCTCTATGCCTATTTTACTAGAAACACGTACCTCTTCTGATCTTCTTCATCGGCGATACGA
CGGCTCTCACTCTACATCAAAAATGCCACACATCCAAACTGTCACCTACAATTAACACTCTTCCAGCCACAAATTAACGCACCACAATGAGTTTGTTCTG
CTTTTGCAGTTCCCGACAGAGCTGTTCCAACTTGGCCCTCGAAGTGTTGGTCTTCACCAGCTCCGTACTCACTACAAACACCATTCGTAAGCAAAAAACA
CAACAATACCTCAACTGCTAAACACACCTGCACTCTTGCGTTGCTTGAGCAGGATACACTTGGCATTCAATTCGCCAATCTTCTTCTGCATGAGCTTGAG
TTGTTCACTCTGTCATCCACATTCATCAGTCTCCATCTTCAACACCTCTTTACATTTCTCCGTACCGCTTGATTGAGATTATTAACGAGTTCTGTCACCT
TTTCTTCGGCTGCCATCTCCTCATTCTCCTTCACCGCCTCCGCCTTCTCCTTGAATTGCGTCGACAGCGTCTCGTCCTGGTAAATGCCCGACAGATCGAT
GGGTGCCTCCAGATTCTCGTCTCCACCCACTTCGATCTCCGCGATTTTTCCTGCCAGCAGTTCCCTCAGTGCGTCCTCGCGATTGGCCTTGGAGTTGCGC
TTGTTGTGCACGTGGTGGCGACCAGGAGACGCTGCGGACGATGACGAGCGCTTGTGCTCTCCCTTGCTGGCAGTCGCAGGAGCATCGTCCTGCTTGCGCT
TGCTCTTATGCTTGTGCTTGAGACTCTTGGTCTCACGACCCAGCTGCTTGAGCTCCAGACTCGGGGTTTCCATGGTGCGCGTCTGCTCGTCCGACATCTT
GTGGCGGTTTGGCTCGTTTGAGGATTGGATGGCGCAATAATACATTTTATTGATTTTGTATAATATAGGTTATTGCAGGTATATCAGTCAACAGAGTTGA
TAACACATCAACGGAAGCTGCATGCGATAACGTCAAACTCTAATACTAACGAATTATGAGAGGTCTGCTCGGTTGTAGTATTATATTGAAGAGGGGTGCA
GCACATGCTTGAGGATGTCGAGTACTGTGGCCGAGTCTCCAGCAAGGGCAGACACTTCCACATAGACCACGCCATTCTCATAGCACCACGATTGAGCTGC
ATCTCGCTCTACTTGAGCATTTTGACCCATGCAGTCGCTCTTGTTGCCTACCATCACAACTGGCAGCGATTTCGGTGCATGAGCTTCAGCGACAGTTATC
TCTTGACGAGCAACGTTGAGGTATTTAAGCAGCACTCGCCACGAGGCTGGCGTCTGCAGACTGAAGACCAGCACCACAGCCTGGACCCCGTGAAAGTAGC
GCGCGAAGATACGTGGTCCCGCGTAGCTCTGAGGTGGCACGTCCCACAGCTATGACATCAATCCTCGTTAAACCAAGTCAAGATCGTCATCAAGCATGCA
ACGACGCACTTCAAGAACAACTGGTTCGTGTTCCTCGAGTCGAAGCAGCTTGACACCTACGCTGGCTTCATGGATCATGGACCACCAACGGAGTCGTTAG
CAACACGCTACTCACTCATCAATCGATTGGTGCCTTGCTTGCTCACCTGTGAAAGACGGCACGTACTCAACATCGAGCGGAGTCCCCATCCAGCGCCTGA
ACAGCGTTGTCTTGCCCGCAGCCGCTTCGCCCAGAACGACTACCTTGACCTTGTCCACGGACGATGAATCCGGGTCCTTACCTTGCACTGCAGGTGCGTG
CCTTCGCAGGCTGCTGGATGCTGCAGCAACAGATCATTAATCCATTCAGCTTGAAGGTCGCAGTCATCCGACCACGTGAGCAATTAGCCTGGTAAACAGT
CAAGACTCGCCTTGTGCGCCCATGTGTTGCGTCGTTTGACCGTCTGCACGAGATCTCGCCTTCGGACAAGTCGCTATATAGTTATGCTACTCCTCTACCA
TAATGTATGCCTTTGTGTTGGAATAGTGGAGTTTATTTTAACACATTGTTAGGACTAAGACCTTCGTGATAGAATATATTTCTCATTGCAAATGAGTCAT
TTACCTCCTTGAAGTAATTTTACCTCTCTTGTACAATTTCTGGCACACGTCGCAGCTGCTTGGTCCGCCGTCGGATAAGGCGGAAAATGACCGCGATCTG
CGTCCATGGCGCTCTTCACTCTGCGATTTCCCGATCCGCTCGTAAGTGTTCGACGACTGAAACTGTACAACCTCTGGACACGCGATGGACCCGGTGGACA
AGTTCAAGCTGGCCGCAGCGCTCTTCATCTGGGTGTTAGCTCTTGTGGGCGGCATTGCGCCATTGCTGAGCAGTCAGCGCGTGAGCAAGCGCGCCAGCAG
CGTTCTCAACATGGTAGCGGCTGGCATTTTCCTCGCCAGTTCATGCATGCACCTGCTGCCGGACGCACAGAACAACGAGGCACTCACTGAATGGGGCTGC
GAACACACAGCCGAGGTGTTTCTAGCCGTGCGGACGCGCTACCACGGCGACAATAAGCGTTGCTTCAAGTGGGCGAACTTCTTTTACGGCTGCGGCTTCC
TCATGGTGCTGCTCATCGAAGTGCTCGCGCACACGCTGCAACGGCACTACGGCAAAGTGCACGGACACGGTCATGCACATGGAGCAGAGCAAGAGCGCGA
CGCGCTGCTGGCCGTCGAGGTCACGCACGCTGCCGAGTTAGACAACCTCGCCAAGACTAATGGACATTCCCATGACCACGCTCATGGTCAGCTGGAGACT
GGAGACTATGGCACTCAAGGAGAAAGCACGGAGTTAGCTGTTTACACCCAAGACGGCAAGGAAGAGCCGCACTCGCACATTCACGGTATCGTCAAGGGTA
ACCCCATTCTAGCACTCGTGGTGTTCATTGCACTGTCTTTCCACTCTGTCATGGAAGGCATGGGCATGGGAGCCTCGAGTAGCCCGGCTTGGGATATCCT
TGTTGCCATTCTTGCGCACAAGTCTCTAGCGGCGTTCGCGTTGGCGCTCGAGTTCCTACACCACAACGTTTCACGAAAGCAGCTCCTGTCCTCCGTAGCA
ATCTTCTCACTCATGACGCCCATGGGCATCCTGTTTGGTCGGCTGCTGGTGGATTCCAACCATGCCACACCTGCGGGTGGTGTCTGTGCTGCGTTCGCAG
GTGGTACCTTCCTATTTGTTGCCATCATGGAAATCATTCCGCAGGAGCTGCAGGACCCACGGTATCAGCTCGAGAAGTGCTCTGCTCTGCTCGCCGGCTA
TGGTACCATGGGCGTGCTGTCTCTGTGGACGTAAACATACTTTTGAACTTATGTATTCTCGAAGACAAGAAGCTTCGATCATCGTTAGGCACTCAATAGC
CGTAAACCGATTCGCCTGGTGCGAACGCCAATTCAAAATTCGCTGATAAAACGTTAGTAAAAGAAGTTAACGAGAAAAGAACTTACTAAGTAGCTAAACC
GATAAGCGTTGGAGTTCTCGCTCGTTCAAGCTTGTTGTGTTCCATCTCCGCACCAGAATTTGCTTCTACAGTAGACGCCGTATCCTCTTATCTGCCGTAC
TTCTGGAACTCCCACTCGCGGTTGTCCAGCGGACACACCTGGCGGGTCTTGAGCCATCGCGAGATGCAGTGAAAGTGGAAGGCGTGGTCTACAGCAGATA
ATAACAATTATCACAAACATGAGTGAGTAAATAATACGTGTCAACCCATCCAGATCCAAAGCGACGTACTGCAGACGCCCCAGGCCACTGTGCACTCCTC
ACTGGTAGCCGACGCCTGGTTCGCTTGGCACTCGATGCACAGGTCCATGATGTGGTTGCGGCAGATGGCACAGTTGTCCACCACGATGTCTGCGCAGTAA
AAGACATTAAAAACATTAGTTGCTGAAAGATCTCGACTGATCGATGAGAACCATCGCAACAGCCGCACCCCAGGACCAGAGAGCCACAGCGTTCCACTTC
TTAATCTCAAAGCGCTTCTCCTCGTTCGTGGTCGCCACCTCCGCCTTCGTCTCGCTCTTCATTTCCTCGTCCATCGCCTCTGCTATAGCTGTAGCTTTAT
CGATTTGTGAATGGTTTCATCATTCTCCCTACATCAGATATTCGTACTTAATTGAGTTATGCGGATAGGAACGAAACACGTCGGAGAGGTGTAGCCATTT
CAACCACTTCAACCGCTTCAACCACTTCAACCGCTTCAACCACTTCAATCGCTTCGATATCTCGACCACAACAATGTGTTTATTCCTATAATTGCTGCAC
TTCCTGTGCAATGTTCCTACCACGCGAGTGACTTACTAGCTCGTCACTTACTGCACATACATTTGGCACTTCAACTACCCACCGAGTAATTCAGCAGTGA
CGGATCAACCTTTTGGCTCTTGGAGCGACGTTTGCCCCGCTTGTTCGATGATCCAGTTTCGGATACACGTTGCTCAGCGTCCTGGTGGACAGGTGACTTC
TTACCGCTGTGTTGAGTCTTCTTGCGTTGGATAAACTCCGTGGCGAAAGCCGAAACGCGGGGTGTCGAGCCGAGGTATGCCGCGAGATACTCGCGAATCT
CACCGGGATCCTCCACTGAAGCACAATATTCCAGTAGCGTCACATTGGCGTTGCTGTCGATCATTTTTAACTGCTTCAGGGCCCACGCCATAAACTCCGA
CGACACGTTATTTGAGCCAAAAGCATTCGAGCTGCTCACTTGAGCATTACCAGGCTCCTTACCCGGCTGGGCTGCTCCAAAGTTCCAGAACGAGGCATCA
CTCTCTGTCTTCGGCGGGGAAGGTTTCGCAGCACCGTTGGCGGTACGGATCTGTTGGCGGCTCTTCAGCACGGATGCGGGAACAGGGCCCAATACAGATC
GGGATGGTTTGGGAATAGCTGCTGCAGCGACCTTGTTGCCCGCCACAATGTTCATCCAATGCGAGCTGGTCGGCGCATTTTCAGTGGATTTAGCTCGCTC
TTGCGCCAGTCGTTCTTCTTCTGCTAAAATATCACGCATTGACTTCGATGTGCTGCTCTTCGTCACAGCAGCAGGTGTGCCCCACGGACTAGCAACAGGT
GCAGCTGGGGCGGGAGTTGGTGCCGGTGTTGACTTTCCTGTCTGATCTTGTGTAGCTGACGGTGCAGGGGCTGAATGAGCGGTCTGTGCAGCAGCGATCG
AGTCCACGCCCAGCATCATCTTTAACTGTGCTCCCATTTGCGCGAGATCATTGCTACCCTTGTCATCGCTCATCTTGTTAAGCATTTCACGCTGCTCTTC
CTGTTGAATATCCTTAAGCGATTTGGAGCTGTTCGGTGCAGATGTAGATACACCACTTGTAGCCCACGCATTCGTCTCTGTCTTGTTTTCTCCCTTCTTC
CCGTTCTTTTTGTCTGGGCTTGGGCTAGACTTCTTCTCGCCACTTTCGTCAGCCTTAACCCCCTTCTTTGTTGATCTGATAGGAGACGCTTCCTTGTGCT
GTTCCTGCTGTGAACCAGTCTGGTCGTCATTTTTGTGAGCTTCAAGAGCAGCACGACGCTTCTCATCGTTTTGAATGTCATGTAGTGTTGGTGATGGTTG
ATCCGGGGACTTTGGTCTAGCTCCCCATGCTTCGACCGTGGGGACAGCAGTTGGACTTCTCGGTGCGGGAGGCTGTGTAGTTTGTGGTGTAATTGGACTC
GGTGGTCGCGCTGATTGCAATCCACTTAACGAGCTCGTGGCGTTTTCTAAACCAGACATTTCTGGGCCAGCGTTCGGCCAAAACGCCTGGTCACGTCTTT
GAACTTCGTCATTTAGAAACAGCGCGTCTTGACCGAGAGGCTGAGGGTTCTGCATGCTTAGTTGGTGCTGAGTGCGGTAGTCGGACTGAAATTGAATCTG
CATGCCGCCTGACCTGAAATTGTCATTTCCTGCAATGGTGGTGTCTTGGCCTCCTCCAAATATTCCTAATGCGCTCATAATACCCTCACGCTGGCTGCGC
TGCCACGAACTTTGCTGCTGCAAGAGCATTTGCTGTTGCTGTTGTTGCTGTTGTTGCTGCTGCCGCTGTTGCTCTTGCTGGTGTTGCAGCATTTGTTGCT
GCTGATACAATTGTGTTTGCTGTTGTTGACGGGCGATTTCAAGGCGCTGCATTTCCATGCGAATCTTCTCTTCTTGGTTTAGCTGAAGCATGCGCTGCTG
TTGCTGCTGCTGCTGAAGTTGCATCATTTGTTGTTGTTGCTGCTGCTGCTGTTGACGCTGTTGTTCGCGCTGCATTTCCAATAGTCGCTGCTGTTCATTC
TGGCGTGGGTCAACATGCATTCCTCCCAGGTCACTCATACGCGCGGGCGGAGCAGCAAATGGCATTTGTCCGTGGACGAATTGATTCGCCAAGGGCGTAA
AGATACCCTCGCGACCGAAACGAATCGGAAGGTGCGGCTTAAAGTAGCCCGCCTCAAACCATTCACGCATTTCCGCCGTCTTAAATGGACCCTGCTGCAA
CCCCTGCGGATCCAAGTAAAACCATTCGTCCTCCACTCCCATGCGTAGTGAAGATATCCCGGCAAAACCTTCTTCTGCCGGCATTTGAGGAAGGGAAAAG
TTACTCTTCTCTTCAAGCACGAGCTGCTCACTGCTAGGCTCCAGGGCATCGAACAGTTGGCTACCGCTTGATTGACGACCCAACAAATTCGCCGTGTGAT
CTTCCAGCGGACCATTAGCATTGTGTTGCTCTTCAGGAGTAACTTCATCCCATTGCACCTCTTCATTATCACTGTCGTCAAACTGTCCAGCAGCTGCAGC
ATCTTCAAGTTTCTTGTCAAAAGCGTCCAAATCATCTTTAATCTCATCCTGTAACAACACCATCATCAGTTACGTGCACAACCCAAGCTGCTGCAGGATC
TAGCTTTACCGGGTCAATCTTCGGTCCCTCCAACTCCTTACGCATTGCATCCATTTCTCGTCGGAACTTCTCCGCTGCCTCCGCCATACTTGAAAGATCC
TGGAGAGAACAACAACAGCCACATCAGCAACGAATCCACTTGTCCATCTCGTTCCAATCGCACCATTTCATTGCTATCCGCGCCTGGCTCCAATACATCG
TCCCACACATCATCTCCTTGCGTTCCCTCCGTGATCTTCGCACCTCGTTCCCACGTTGAGTCTTTCTCATTGTGTCGATGGTCTTCTTTCTGCTTGGTTC
CTTCCGTCTCTTCACGATTTCCTCGTTCCTGATGTCCACGCGAGCCTTGTTGTCCTCCAGAGGGAGCATTGCCACGACCACGACCACGTCCACGATTGCG
ATTGAGTGACCATTGCTTGTAGATCTCCTCATAGTCAAAGGGAAGCGTACTAACAGGTGGAAGACTGTGTTCCGAGGCCACGGACGTGTCTGGTGGGAAT
TTGGGCGCTTCAGATGTTGTGAAATGCAGCGCCAATAGCTCCTCTTTGCTGTAGCGCAGCACTTTGCTCTTGCGTCGCTCGCCTCGATGGTCATCGCCCT
GTCCTGTGGCCGCGTCTTTGAAGGACGTAGAACCGCCGCTCGTCGAGGCCGACACGAAGCCCTCGCCGTCTTTGGACCACTGCGGACGGTACGCGGAGCC
CTCGGACTCGGTGCGGCCGCGGCCCTTCATCGCGAACATTGTACGTGGTCGCAGCGAGATGTTGCTGTTGGCTCCGTTGTTGGCTCCTGTCGGGGGCTTC
TTGGCTGCGTCGCTAGTGGTGGAAGCCTGCTGTTTCTTGCGGTGCTTGGTGGTTATGGTGACGAAATCGTCGTCATTACTGGGGCTGCTCATGGCGCTTG
CTCTGTCGTTGGTTGCTCCTCCTTCTTTGGTGTGGGGGGCGGTGCTGGATCTGAGGTTTTTTCGGTTTTGTGTCGACTAATTGTCGGAATTGGGGGGACT
ATAGTTGGGATTTGGGATCAGTCAGGACCAATCTTGCACGACCATGAACGGAGCTGGGCTGCGTAATTGGCGGTGCGTAGTTGCCGCAGAGACGATTGTC
TGGGCCTACTTACAACATACACATGCTAACATTTGTGGTGCAAATGTCTGGGTAAAACTCACGTGCGTAATTTGATTGTAGTGGCGAAATCATTCAATCC
AAAGTCACACCGTCGGGTGATGGAGTTGCTAAGGAAGGCCAAGACTCGTTGAAAGCGACTACAGCTGGTAACGACAGTGATACCAGCAAAGTGCCTCATT
CTGCACATGCACCGAGGCAGACAGAACCGTCGGAGCAGACGAAAGTGATTCGCAAGGATGAGTTTGGTCGCGATGTGGAAGTCAAGGTAAACCGAAAGGA
GGACAGGAAGAAAGAGCGAAAGCACAAACACAAGAAGCACAAACACCGACGTGACAAGAGCCGAGATAGATCACGATCGAAAGCGCAGAGTCCTCAAGGT
CGACTGGTTGGTACACCGCCGCCACCAGACCCGTTCCGTCCACAGGTACAAAGAGTAGACATTTGTGTGTTGATAGCGTGCAATGGGCACTGACCATTGC
TGATATGATTTTTGATAGCTGGATGAAGGTCGAGACAGACGCACACATCGACGAATTGATTATAGAAGGCGAAGTCGCAGCAGGAGCAGGAGCCGTTCAC
GTCAACGCAGTCGAAATCGAAGCCGTCGAGAAGCAATAAGTAGTGGTAGTCACCAGCGGCACCGTCGTCGGAGCTTATCTCACAGTCGTAGCAGAAGTCG
AGGTCGAAGCCAAAGTCCACTGTCTTCTCACTCTCGACGTAGACGCTCACCAGTCTCAATGGATCGACAGTGGACTCACAACGCCTTCGACGGTCGCAGT
CCGAGCCCACCGCGACAAGTCGATCCATCTTACCGACCAGAACCTGAGACCTGGGTGTCACGAGCAGGCGGTGTGTACTTGCCTCGCAAATAGCACCGCT
CGGAAGCGACGTGTCGTCTAGAATCGTTGGACAGTGAAATGAGCACGCTCCTCCGTGACTGGGATGAAAGTGCGTACGCACAGTCTATTATTCTTGATGA
ACTTGCAATGACATAACTGGTTCCTTGATCTATTGTATTGTTCAGGCTCGAAAATCAAGCGCAAGAAGCTGCTAGAATGGTTTTGCTCCCGCTTCAATAC
GTCACAAGAAGGCGTTCGGATGCTCGAAAGCGAGTATGGGGTAGACATTGCTCTTTTCTTGCCACGTCTCCTATCGTGGATGCAGAAAACAACTACAAGC
GTCGTTGACAGCACTAACGTATGTTGCAGCGTCACGGCTAAGGCTGGAAAAGTAAAGTGTTTTGCGCTTGCAGAACAAGTGGCTTCTCTTCACGTATTTT
TCAAATCAGCAAATGCTCATGCATACTATCGAGAGTTCCAGCATGCTGATGGTCTTCGATTGGTGTTGAAGGTCGTGACCATACATGGATATGATCCTCA
CACTCAAAAACCGTTAGTGTCACTCACCGATCGAGAGACTTTGTTTCGCATCATCCTACGGATCTCCAAGATGAGCCGGCAGTGCAAAGAAGAGATCAGT
TGTCTTGATGGCGAGTTAGCTGTGATTCGTGGAGTTTTAGCTAGTGGTGATGTTGACGATTGGAAAGCAGAGTCTTGTGTGTGGACTCTTTGTCGGCAGG
TGCTTCTCGAGCAGCTCGTTGGCAACCCTAACAGTGTCGATCGAGCTCATGAGGCGATTGTATTCATGTTAAAGCACTCGGAAGTGCGTCTTCAGCTCTT
TGGCGCACAGGTAAGTTGGATTCTTGCACGTAGCATTTGTATTCGTGTGACTCACAGCTACTCATGCTTCGATGGTAGGTTCTCCGCGAGTTAATCGCCG
AGAATTCATTCTCGTTTGACCCAGAGTATCGAAGACGGAAGGAGCACGATCTTGTGAATCTGTGCCTGCCTCTAATTAACTCGGCTGACGTATATCTACA
GCACGAAAGCCTTGAGCTTCTCCACGCTTTATTGCAGTCGAAACACCTACAGGTTTCTCAGTATAGCACTTTCGGTGCAAAATTACTGATTGATGTGGTG
CAACAGGATCTCATTTGCGAGAAACTCGTTCACTTAGTCGGAGACAGCGCCAAGGCCCTGAATGCGTATGCCGCAGTATCTACTTCCAACAAATTACTAT
TTTCAAGATTCGCTGACGAGTATGATGATGAATAATGCCAGTAAGACTGAGGAGCGCTTCACCTCGATTGAAGACACTACAGAGCATGAAAATTATGTCC
ATATTCGGTCAGCTTTTTCTCAAGTATGCCAAGCCGTCAACACTTTAATGAACTCAAACCGTAACCTGGTGCCGATTCTGGTACGTCCACTCTCCCAAAC
TCGAGTCCATTCTTTTCATTGACCGCAATGTGCAGGTCGATCAGTTTGGTTTGCTTACTCCTTTAGCCTTTGTGCTCGTTATTGAACGGCCTCGTTCCCT
GAAATGGCATGCCGCTGCGATCAGCATCCGATACATCTTGTCGCATCACTTCCGGGTACGCATCTTGCCGACTGTAGACAAACCTTCATACTCATTACCA
TTGTTGATGATGATAGGGTGCAGCTGTATGTATAACTGAGCTCTTTGAGATCCGAATGGAGGAGCTCCGTGAATGGAAAGACAATCGAGAGGATGACAGT
GAGATGCTCGCCGATTTCCTACTAGGCGATGAGACTCACCAAAGTCACATTGCACTCCGATTTTACCAACGGGGCTGGTACCGTCCTCTGTCTCCGAGGA
AGCAGTCCGAGCAGGACACAGATCATATTCTCAACGACATTGAACATAGTGTAGAGACAGCAGCACGCGACTACATTCCGGAGCTACAAGTGCAAACGCG
CGTGGGCGAGAACGTCGATGACACCGAAGATCTGGAGATCCTGGAGGCACAACGAGAACAACACCTGCGCCTTCAGCTGCAGAAGCATTTTGCTCAGTTC
CGCCACATATCTACATCAGCAACAGCCAGCCCCTAGACAAAAAGCAATCTACGTGAAATTAATACTACGGATCAATAGGACAGCGCCTTCTCCGCCAAAT
TAGCTCTCTTCGGGCGTATAGTTGTCCTCGAGGAAGCGTGAGAGCGTCTGCAGTTGCTCAGACACAATCTTGACCTTCTCACGGCAGATCTCCACGTCCT
TTTCGGCACCATACGTGCTGCGTGCGAATGTGCGGTAGTCCGAGACCAAGTGGATGTGGTTGGCCAGCTCAGTGTGGATCTCCTTGACCAGCTGCAGAAA
CTCTGTACACGCCGAGTTGAAGGCCAGCGACGAGTTCTCCTCAGACGACACACGCGGCCCCATGAGCGTCATGGCGGTGGCTGCCGTACGCAACGCCGTC
ACCAGTTTCTAATAGGGAAAAGGTCAGTGGATCTGCGAGTATTTTACGTCCTGACAGCGGGTGCATGCAGAATTTTCGAGGTGGTAAGCACACAAGTGCG
TACCTTTTCGACGGCATCGAGCGCCTGCAGCACGGCTACATGCCGGGAGCTGGACCACGGGTCGTTCACCTCCGAGAAGTGCACGCGGCTGTCACCTTCA
CTGTCCATGATAAAATGAGCCCCTGATCGGCTTGAGCAGGGGCCTGTTAGAACGGATATGGATACAAATACCGAATTTGGGATCTGAGCTCGACATCGAC
TAACGATCTGTCGCTCTTCTACAGACATCTTGAGCTTCCCTATGCCAAGCTTGTGATCCGTATTGTTGCGGCGTTGACTCACGTTGGACTGGGCCGCCAT
CCGCTGCCGAGGCAGCTTCTGGTGCAATTTCAATCAGGTGCCTTCATGTCGATATTTCGAGCTCTGCCGCCGATAGCCAGCTTTCGCGCAGGATCACCTT
GACACCATGAAAAGCGACCCAGATGATATCATACAGTTTGTCGCGCTTGGCTCTCGGTGGGTGTTGACGAAACCTATCATTATGATAAGCTCGTGGAGAA
GAGTTGGTACAAGAGCGCTGCCACCGTCGCCATACGTATGGTATCCAGAGTTAAGTGTGCTGTAGTGTTAGGTGGTCTAATTGCAAGCATTCGACTTGTG
GTGGTCTTAGTCTCGTGGCGGCGGTGCTACGATTTACGAGACTAGTTTCGATTTCGATGCCTCGAGCGTGTCGTTTCGCGCACCTAGCAGTAGCCACATC
TGCATAGCCAGGCTAATTCAGACCTTAAATTTGGCAAAAAAATCCCTATTTGTGGCATTCGAGCCCTGCAAAGATGCTTTCATTCTTCCCCAGCAGACTG
TAGAGTAATGACAGCTCGCAAGAAGTCTTCAAACCCCAGAACTTCAAAGTGTAGATTATGGTAATCTTCAACTACGGATGCTCAGAAGTAGGACTATACA
CGTAATGCAACGCCTCTCGTTGAGGAAGCAAAGTGAGTGGCGGCAGTCTGTAATCTCTGGAGTGTCGTTAATTTGCGCTTTGTACGTCATAATGGGGTAA
CTACTCGGTATCCAAAGTCCTAGCTGTGTCGTGCTGCTAAATAGCTCCGCACCCGGACGCCACATCTAAGCCTCTAGAAAGTGGCAGACGTCGTTGTCAG
TCCGCCCTGCCCTTTCGTCAGCGAATCGCGGTGCACCAGCGACGGGCTGCCCTACCCACGTCAGTCCTTTCCTATTGCTAGCCGCACGTCAACACATACA
AACGTCAAGTCAATCTCTTCCACCTAATTAGTAGTGGCACGTCCGCAATCTTGCAAAACATGACACGATGCCATTCTCGGTCTATCCCACGACGCCGCAG
TCGGCCGTAGCACTCGAAGCATGGCATCCGCCACGGAAATCCTTGCAGAGAATGAGCGTATTGCGCGCGAAATCCATGCGCTACTGAGTGCCAATACGAC
GCTGGAGAAGGAGATGAAGGTGCTGAGTTCGGAGCGCGATGAACTCGAGAATCTCGGCAGCAAGAAGGTGCAGACGCTGGAGCACGAGCTCGAGACGGTG
GACCAAGAGCTCACTTCGCTGCGTTCGCAATGCCAGTCAATGACGGAAATCATCAAGAACGATGCCGAGAACGAGATTGAGGTCGAGGAAGAGCCGGCTC
CAGTGCCAGTCAGTCGCAAGTTGTCTTCGGCCATCAACCAAACGATGCAGCGAGCCAGAGGCATGTCAATGCCCCGCCAGCGACGGTCGTCGACAGTGGA
AATGGTAGCCCACGGTATCACCAAGGCGGCGAGCTACATGATCCCACCCACAGCAAAGACGAGTCCTGATGGACCTCGTCGTCCAAGGATGAATAAGGAC
AGCCCACCGATCTTGTCATACTCGAAAGGCAAATCCGACTCGTCCAAGAGTCTGCTCTTCTCGACTCACTCGCACTACGGCAATTTCCGACGTCACAGCG
GACCGTATCGCAAGACTCGTGAACAGGCTCCTGTTATGGTGCTGTAAGGCACGATACCCGATGCAAGCATCGCAAGCTCCTGCATTCATTATTTAACTCC
AACAATCCCCATGTCCAGCTAAAAGTTAGCTACATCCGTCAAGTCCAGTCGAGCGTCAAGCGTAATGCTCTGGAAGACCTCACAGATCACCAACCACCGG
ACTTCTGTCCTCTGCTTTTCCGACGGACAGAAATGCAAAAAGAGGAGAAGACCAGGTCGACGACCCGCAAGAAAGTCTTTCGAGGTGGTACACTCACTAT
ACATGTTCAGTCTTAGTCCAATCAATGCAAGTGCCTACCCTGTACGAAATCGATTGTTGTTTTATTTCGTATTCCTAGAATGTGTAGGCAACAAGAGCAC
TTGACTCAATGATTAAGCATGTTTGATATGTTTATTATGGATCTTCAAAGCTTCCTAGCTAGCTCAACAACGCACTACTACTACTGTAATGGAGGGTATA
ACACTGCATTCGAAGCGCCTAGATGACAACACGCTTCATGCTGTCGCCCATGGCGTCTCTTCGTCTACTTACAGCGCGTTACCCGACTTCTGGCGCGCCA
GCTTCTGTGCCTTGAGAGAGGCTAGCGTGGGACGCTCGAATTGCGACTTGCCCAACTTGCGGTTCACGTAGTACACGCGACCCGTGGAGCGGGACACTTT
GGCTTCCCAACCGACAGGCAGAGATACCTCCGGCAAGGCGTCCAAGTTGAACGACTCGCGCACAGGGCGATCCACCGGCTTAGCTGCAGGCTTCACCTTC
GCACTCTTCGAGGTAACGATAGTTGTCGATGCGACGTTGTCGGACGTGATCACCGCTTCCTCAGGCTTGCTGTTCGTGCGCTTGCTTCGGTTGTCGTACA
TGCCCTTCACGACTGACATGCGGCCCTTCAAGCTCGACATGGCACCCGTCACGCCCACTTCCACGCTCTTCACTATCGTGTTGCGCGTGGTGGAGCTGTT
GGTGGGGCTGTCCTCACTGTCAACCTCTGAGACATCGAAGCCGTCGCCATTGTCGCCCTTCTTGTTCGAGTTCCAGAAGCGAGAACCCACGCTCATGCTC
GGCATGCGCGGGAAGTGACGTTCCGACGGACGATTCTCCGATGAACCACGGTTGAGGTCATCCGATCCAGTAAGAGAGTCCATCAGCACGGTCTCGCGCG
GTTTTTTCTCCTTCTTGGAACCCAGCGTGCGGAAGATCGACTTCTTCGGTGTGGGCTTCTTCTCAGGAAGAACACCGTCCGCATGAAGCTTGGCAATCTG
TTCGGCGAGCTTTTTGTTTTCGGCCTCGAGCTGCTGAATCTTTTTGTCCTTGTCGCGCACAGTGTCCTGCAGTTGGCGAACCTTAACATGGTTACCAGCC
GTTGAGAACTCCTTGTCGCTCTTGAACTTCTCAATCTCGACCTTCAAACCCTTCATCGAAATCTTCATCTCCTCATTCTTCTCACGAAGCTTCTTGTTCT
CGTCCGTAAGAGTCTCAATCATGCCACCAGCGTCGGCCATTACCTCGCTCGAGGCAGCGGTCGTGTCCGCCGTCGTAACACTGCTGCGGCGCTGCAGCTG
CGCATTCCGTTCCTGCTCTTCCTGCAGGGCGGCCTTCAGCTTTTGCAGCTGGTAAGCCATGTCCGCCTCACGACGCTTCTCCTCGAGAGCAGCCAGATAC
TTCGGCCTCTGAATAGTCATGCGAACCATGGCTTGCACACGGATGACCATCGCACGCATCTTAACGTAGCGGTGACGCTTGACAAATCCACGGACATACC
GCTGGATAATGACAGCGTAGTGGTTGCTCTTGACATCGGCTGCCACCTTGCGGCCCTGAATGCCTCGCCAGCGTGCTTGTGCCTTAGTAAGACCCTTCAG
GAACGTGTTGTATCTCCGCATAGCAATAACGCATCGAATGACCGACTGCAATTTGATGATCGCTTCCAGTTGTCGGAGATATTTGATGCGCTGCGTGAAG
CCAACCATAATGTTCTGCAGGTATGTGGCCTTAGCATCCAGGAACTTTTTACGGCGGTCCTCAAGCTCTTCAAGGACACCAAGCTGGAAGTACACACGGG
TCTTACCCATCTGGTACTGTCTGGGAGACTCAAGTTTGAGTTTGTCCATAAGCAGCTGACACTTCTCTTCTGCAGTCGAACCGCCACTCGGCACAAACAG
CCAGAACTTGTCCAGAATCTCCGTGTGTTGCAGCCGATTCGGGTATGCTGCGCGTGAGATACGAATGGCCTCAATCACACCTGCACATCGCAATTGGGAC
ACCACCATATTCTGATCCATGGCCGTCGAACTCTTGATCGGGTTGGGCTTGATGCAACGCACGTAGTGCACCCGGGTCGAGTTGATAGTGGCCATCAGCT
CCGTCAGACTCTCCTTGAACTGAGTGCCAACAGTCGTGATGGACAAAGCACCACCGCGCTTTCTGCCACCACCCGACGCCTTAGCAACAGCCTGCTTTGG
CTCCGGTTTCGGCTCGAAGAGTTTGGCAATGAACGGTTTGGATGAGCCACGCATGAGCTCGGACAGATCAGGGAGAAGCGAGTCCTTGTGTTTCTCGAGG
AAGCCCACCGAGTCGTACATGACAGGTGCAGCATAGTGCTTGATGAGGAACTCGGTGCGCGATGTGCGCGGGAACTCAATAACGTGCGCCATGTCATCTT
TGTGCAGCGATGTCACCTTGGACATGAAGGACTCCTCATTACCCTTTGGTCGCATGACCTCTTCGTTCAGCAATGAAATAATACCCATGCGCGATTCAAT
CACGGTCAGGACGTCCTGATTATCCGCATACTCAATGTGGTCCCACACAATGCCTTCTTCTTCATACTCGATCTGCACAGTCTTGAATACATCCTGCGTA
AACTTCTGCTGAAGCTTCTCATTGGCGTAGTTAATGCAGAACTGCTCGAACGAGTTGTGTTTGAAGTGCTCGAAACCGAAGATATCAAGCACACCAACGT
GGTTTGCCATGTTGGCATCGTCGGCAAGCGACTGGTTAATTGTAGTCACGAGCCAGTCGAACACGTTAGAGTAGATGGCCTTGGCGAGTGCATCACGGCA
GTCCATGGCCAGCTCCTTCTTCAGCGGCACGCTATACACATCGTTCACAGCGCGCATGGTACGCGAACATAGAGCAGTCTGGAGTGCCTTCCAAGTGACA
CCAAGCATCTCCGTCGCAGACGTTGCGCCAGTGTCGCCATCCGTGATGAGAGACTTCTCATCATCTGCCGGGTCCGACTGCAGCTGCACCTCACCGAGGT
GAAGCACACCAGCCAGTACCTCAAAAAGCGGTCGTTGATCGTCACGTGACAGACCCACAAGCTCAAGCGCCTCGCGCGTCTTGTTAAAGTGCTTCTCGTC
AGAGAGTCCTTCAATCTTCTGTGCTGTGTTGTCACCGGTGTAGACGTAGTGTTTTGATGAGTCAAGTTGCAGCTCCGGTGCAATGTCAGGGGAGTCCAGC
AACTGGTAGAAGATGTGGTAGTTACGCTCTGGCGCTTCGTGCTGGATGACACGCGTCTTCTCCAGCAGGTACGTCCGGCACTTGGCACCAACAAGCGTGC
CGTTCTTGTCGAACTGCAGCTGTGTGAACTTGCCGAATCGACTGGAATTATCGTTACGTACAGTCTTGGCATTACCAAAGGACTCGAGGAGTGGGTTCAC
CTCGATAATCCTCTTAATAGTAGAGTTGTTAAGACCACCAGCAATAGTTGCCAGATGGTTCATGAGGATCTTGGTGGTCTCCGTCTTACCAGCACCAGAC
TCTCCACTCACCAGAATGGACTGGTTGCGTTCCGAACGCCTCATATTGTCATAAGCAGCGACTGACGTGGCGTAGACGTGCGGGGGAAGCTCTTCCTTGG
GTTGGTTAAGGTACCGGAGATGCTGCTCTTCGGCATAGAGGTCAGGGAGCCACTTGTACGGGTTCACAGCAATGCAAATGTCGCCCGTGTACGTGTAGGG
CAGCTCACAGAGGAAACGCTTCTTGACATTGTACAGAATAGCAGCTTCGTGGAGGTAGTTGAGTGTGATCATGTCTTCAATACCTTCGGGACCCACGTTC
TCGTTCTGGTAAGGAAGCGACTCGAGCTGGTGCACGTCCAGGAGCGCCTTGGTCTTCTTGGACAGCATATCCACGCATCTCTCTTCAATCTCGCCGTCAG
GCAGCTCCACCTTGCAGTAAATCTTGCGGGTCTTGCCGTCGCCCGAGTTCTCATCACGCAGCACTTCGGCCGCGAGCCACACGTGCGTCTCGTCTGGCAC
GAAGCACTTGGCGCCTACCACCATCTGCAGGTCGCTCATGGTGTCTACGTACAGCAAAGGAACGGAGTGCGCGCGAGGACTGCCAAAGCGGAATGCGCTC
GAGTGAGCCAAGTGGAGGGGGGATTAGATACCGCATAGAACCGGTAAATGGAGCCATCTTGCGACCGGCAACTTTCTACACTTGAACTTTGTATGCACCC
CCTGATCCGACAACAACATAGCCCGGCCAGCGCAGCTGGGGCAACCGGCTGGGATTGACGGACGGCGCGCGAGAGGATTTGACTCTGACGCAGGGTGCGG
TGCTGGCGTCACGGCCGTCGTGCGGTGCAGTAACTATGGCTACGTGCCTCTTTAGACCGCTGTAAAATTGCGGTGCGTGCCTTCATGTGGCAACGTATCG
CACCAAAAGCTTCTTCGTGTAACGCTAGCACTTCCAGCGACGATCGAACTCATTTCAGGGTCGTTTTCTGCACCACATGATTTACCGCTGAAAACCGATA
GCTTGAAGCCTCCCTTGCCTCATACCAACGGCCTGCCATATCACATACCGGTTCTTAACCTCCATCGTATAAGCCAGAGTGATGGTTAAGGGCGCAATCA
AATGCAATCACCACATTGACCACCTCACTTTCAAGATGACGTCCATGCAGCTACGCCGATTAATGCTGAGTCGCAGTCAGCGCGCTCTTGGCGTCCGTCT
GGCTCGCAGCTTCAGTGCTGCCTCTGACTCTCCCCGTCGCCGTGTGTGTGTGGTTGGTTCGGGTCCCGCTGGCTTCTACGCCACCAAATATCTGTTGAAG
GAGCACTCTGGTGCGCGTGTGGACATGCTGGAAGCGCTGCCCACGCCGTTTGGGCTCGTGCGCTCGGGCGTAGCACCCGACCACCCGGAGGTGAAGAGCG
TGATGAACGACTTTGACAAGGTGGCGGCCGACGAACGCTTCCGCTTCCTGGGCAACGTACGCGTGGGCGAAGATGTGTCGCTCGCCGAGCTGCAGCAGCA
TTATCACGCGGTTGTATTAGCCTATGGTGCCGCGGGCGACCGCAAACTGGGCGTTCCAGGCGAAGACCTGCGAGGCGTTCTGTCGGCGCGTACCTTTGTG
AACTGGTACAATGGCCACCCAGCCTTCCGCGATCTGGAGCTGGATCTGAAACAAGCAGAGACGGCAGTCGTCATTGGCCAAGGCAATGTGGCCGTGGACT
GTGCGCGTATCTTGACCAAGAATGTGGACGATCTGGCGACTACGGACATTGCAACTCATGCAGTGGAAGTATTGCGTAGCAGCGGCATCAAGAAGGTTTT
CCTTGTAGGCAGACGTGGCAGCGCACAGGCGGCATTCACGATGAAGGAAATCCGAGAGCTGACTAAGCTTGATGGAGTTGTGTGTGTTGTTGACCCAGAC
GATTTGGAGCGCAGTAAGACGCCTGCGTCTGAGCAGGAGATTATGGAGCAACGCGCTAGGAAGCGTATGAACGACTTGCTGATCAAGGCGGCGGACCAGT
TCACGAGTGCTGATGACGCCAAACGTGTTGTGCAGATTAAGTTTTTGAGCTCGCCGGTGGTGATTGTTGCGGATGAGAAGGATTCAACTCAAGTCGGAGC
TATTCGTGTAGAGAAGACGAAGCTGGAGGGCGAGCCTAATCAGCAACGCGCTGTAGGAACGGGGAAGTTTGAGGACATTCCGTGTAATCTCGTGCTACGC
AGTATCGGCTACAAGTCACTGCCTATCGAGGCTGATGCTCCGTTTGACAACCGTCGGCACGTAGTTTCAAACGACCATGGACGTGTTGTCACTACGTCAA
AAGGTGGCGAGAAACAACCTGTGGTTGGCTTGTACTGCACCGGGTGGGTAAAGCGTGGTCCCTCTGGCATCATCGGCACCAACATTGTGGACGCACGGGA
GACGGTTAGCTGCATCGTTGAAGACTTCGCAGCGGGAAACTACCTTCACAGTGATAGCATTGCTGAGGAGGACTTGGGTGGACTTGAGGCTGTGGAAAAG
CTTATAAAGAAGCGTAACCCGGACAAACAGCTCGTTAGATGGGCTGACTATGAACGCCTAAACGCTGAGGAAAACCGCCGCGGTGAACTCGTCGGAAAGC
CTCGCGAAAAGGTTACCTCTGTGACCGAGATGCTGGAGATCGCAAAAAGTGCCAACTGATATAAGTAGTTGAGACTCATTTGGAGTAGAAGTACACACAA
TCTTGAAGAACTACTTTCCGCTTAAGACAACTACAGGAGAACTTCAGTTCCTCATACCATTACGCTCTTTTTGACGAGTAAGCGCAGCATTAGCGGCTTT
CAAGGCACGAGTCTTCTTGCGCTGTGTACATCAAACGTGACAAAGTTAGTTCTTTAGACGCACCAGCCACAGCGGAGAATTATCACTTACTGTACCTCTT
CTTCCAGCAATTTCATCAGACGCCGGCACTCCGCTGTGTCTTCTGCATTTTCATCAGCATGTTGCTCAGATCTAGGCTGGAATACATCGTTCGTACTCTC
GGGTTGTCCTTCGTATGTATTTTGCTTGTTGCTGTTGAAAGTGACAGGATCAACGAATGGGTGGTTCACTTGGTCGCGTAGAGCTGCTGCATACGTTGGC
TTAGTTCTTCGCACTGGCGCTGATACTGGTCGCTTTGATAATTTAATTCGGTCTATCGCTGATAATATCGGCGCAGGAGAGTGGAGTCGAGCTGCTGCCG
TCGTCATCTAGCCACGCACATTTCACGGTTAGAGATGAACACTATAATCGCTTCGATGAGATATTCTTACAATGGCTTTCACGTGCCGTAGCTTCGTTGG
ATCTGCCAATATATTCTTTGGCATTCTGGAGCAATATGCCATGAGTTATCATGCTGGATGAGTCAGCGAAAACGTAGTTCACAAAGCTTTCCGTACCGCT
GACTTGTGTCCACAGCGCTTACAAGTTTTCCGACGTACGTGTATAGCTCCAGGCAATCGTCGCGGATATTCTACAAGGATGGCATCAGTAATCTGCTAGG
ACATCGCCAACTCAAACCTTCACACACATCCATGTTTTTGATTGTCGTCTCCTCCAGTTGGTGCAGCTTATTGTTTGCAACATTGAGCTCTTCTGTTTTG
TTTTTCAGAGACTGGTCGTACTGGTCGAGCGATAAAAGTTAGTTAGAAGCATAATTGTATGGACTCGAACCTAAAGCAGATTTTCTTGCTCAGTTTACCT
GCTGTCGAATGAGAGCGATCTCATTCTCTTTTGACTTTTGCAAGGCTGCTGTCCGCTGGCTTAGTTTCTGGTCAAGAAAATAGTCGAACGCGTTTGTCGT
GTTGTGTTAAATTGCTCCAAGACATGATAACCATTGCTTACCTGTTCGAAATGTTTTCCACGAGCTTTTGAGTTTTCACCAGCATCTATTTGTGAGTTGA
TGGTCGCAGCGGAGCGCTGGTGGTACGGCATCTGGATATCCATGTTGTTGTGTGGCTTGTTGTTCCGGCTAAGAAGTTCTTGTATTTCTGCTCGATGTCG
AGCTGCCTCGGACGCTAAAGCACGCTCATACTCGCTTGATTTCTGCTGTAAACAACTCTCCAACGTGGCAATTCTTCGCTTTTGGTCATTTATAATACGC
CGTGCATTTTCCTTGTCTTGTTTTGCTTCAGTCTAGAACAAAAAGCGTGATAAGCTCCAGCAGATCGAAGATCAATAGTGATGGTTGGTACTCACCACGA
CCACCGTGAAATTGCTTTTTGCATTGGCATATTTTTGTCGTAAGCGATTTCTGTCGTTTCGAGCTTCCTCCGCTGTGAAGATGAAGCGAAGAAAGTGAGT
ATAAACTTTCAGATGTCTACTTCAGAAGTACGCCACTACGCACCATTTGCTCTTAGCAAGCCTTGGATGTTCCCTGTAGGTCCAGCGTGTTTACTATTTA
AGAACGCATTGGGAGTTGCACTACGTTCCCCTTTATCTTCATCTGAAAACACCGACTTCAGCACGAGACCATCCTACGGGCAGGTGCATGTTAGGTCAAT
TACTGGGATCCAATGGAATGCTTTGAGCAACCTACTGCAAACTTGATTTCGCCATTTTCCGATATCTCTTCAGCCTGAAACCCGAGCTCATTTAATGTGG
TGACAAACCGATTGTTGTATTCAGTGCGCAAACCCTCAAGCTGTCGGCGCAAAATACTTAACTCTTCTTGAAGCTTACGAATTCGCCGATCCTTGTCTGC
GATAGTACCATTGATGTGATTTACGCGGGGCTACGCAGACCAAAGCGCTATGTTAGTGCAGCTACGATGCGGTTTGCATAGCATAATTTACCTGATTTTG
TACGGATCGGCAACGGTTTGCAAATTGCAGAGTTCCCAAGCACTCTTCGTAGTGCTCTTTCATCGGGTGAATTGTTGCAATGAGCGTGGTAAAACAATTC
CCACCTGTAGACGAAGGATTAACTGATGTCAGTTGAAGACCACAAGTCGTACAACTTTGTCACGTTAGTCAGATACGAACCGATACTATTTTGCAGGAGG
CGTGTGAGCTTTGAGTCTCTATACGGGATGTAATTGTAGCCGCTCTCTGGATCCAGCGACATAACGACCTTGCCAACAGCACTCAAACTCGAGTTAATGT
GCAATGCCTCCTTCAGGCGCTGGCCATCTGATTCGCTTTTCTTGAGGCGTTCAGATCTAACAACCAAAAAATACACATGTCAGAGCTCGAGAAGCAAATA
AATTACTTCATTCATATTCATTAACGTACCCCGCGAGATCAACCATGTTCAGCATTCCATAAATCACTTCGTCAGTATCGCGAACTAACATTCCAAAGCA
ACGTTAGATAAGTGGGCAACAAATCGGCAGCGACACTGCTACATCACCTTGTTGAAAAACGTGGATCGTAAAAACTGTGTGTGAGCGTGATGATACCGCA
TTCATTTTTGTTTCGTGTGTAGATCTCAGTTTAAGGCCGCAATGTACAATAGCATCCGCCTCTTCTCTAGAGGTTACAGTGACCATGGAAAGGTCTTTCA
CGAAAACTCTGCCTTGAGCGTCCTCGTGAATTTCAAAGTTTGCTATTTGGTATGGGGCACATAAGGGAAGATCCATTATAACGTATCTGACACCGTACAA
GAGTGTCCTACCTTTCTCGTAGTCATAGTCTTCTTCTGCTTTCGGTGGGTTTGAGCTAAAGCTGTTTACGCATGGATAAAGTGATGGTAAGCTTTTAGAC
ATACAAACATGCTCCTTTGAAGTAAATCGCATACCTTGCAGCGCTCTCGGTTCGAGGAATTTGTTGTTGTTGCTTATCAGTAAAATTGCATTGATCTTGT
CAGTACAAATAAATCGTGAGCTAATCACAAACTAGCTCACTTGACGAAGAAACCATTCAGTACTGCTTGAAGTCTGGTATGACACTGGCCGACCTGTCTT
TTTGAGGTAGCTGTAGTATGTGTTAATGAAAATCAGGTCCAAACAATATCGATCGCAATATACTTACGCTCGTGCGAGATCACGGACTCGATCGCAGTAG
ATTTCCAAAAAACTAACCACAAGAGTTATTTCCTATTCAACAGTAGATGGTGATATCAACACTGAGATACGTCGCGCTTGAAAGGTATGCAAGGTCTCAC
GTACCTTGGACTTGCTGTTTTGACGATTAACCATTTCAAACAGGTACTCGATCGACCGTGACAATAATCCTACTTTCTCTCCTCCAGGTTCACCAAAGAT
ACTAATGTGCCAGAACATGCAGCCTGCCAGTTATATGCCAATACCCTCGCTAATATATAAAGCCCCAATGGTTTACCTGAATGTTTTACCTGAACCTGTT
TGTCCGTACGCAAAGCAGCAGCTATTGATGCCTTTCAACGCGTAGTCCACTAAGCATTTACTTGTCTGAATCGTGAATTTGTACAAGTAAGTAGACTGAG
GACATCGCCAGCTCCGCATATAACATTAGAATGAAATACCGCTTCAAAGAGTGTCTCCTGAGTCGTGTCAGTCCAGTATACCTTCGTCAACATCGTCAGT
ACATCTTTCTATCGTGCTTAATCCACTCAGTTGGATTGTACATTATCAAAGCTGAAAGCGTGATTCCCGTATTGCATTCGCTCCGTGTCCTGTTCACCAC
CAAACAGGTTAATTCACTCTGATACTTACGATTCAATTGCAAACATCTACTTTGATCACGATATTGCTTGGAGTTTCCTTCTTCCGCTCAAACATGTCTT
CAGGAGCACTCTGGCCATCGGCACAGGGTCTCGCGCGAACATACACCTGCAGTGATAAAGGCACCAGACCAATGGAGATCAGTAAAATGTTTCATGAAAT
GGAAAATATGTATCAAGAACCACCTTGACGTTTGCGTTACCGAGTAACCGGGTGTAGTCGGTGGTGACCTTGTGATCCATGACGATGGACCACTTCTCTC
CCTAAAGCCTGGTGAGTTTCTTCGCAGGATGAACGCTACTTTTCAGTTATTTTCAGTTTGCATTGTAGAGTTCGCACACGTCGCTTCAGCTGCACCACCA
CTACCTCATGGGGATCACTAGCATCAGCATGTCGAGCAACTCGATTGAATATCTGCACAATGTGCTTACACATATCCAGAGTCTTTGTGCGAAAGCTGCC
GAAAAAGGCAACACCGACAAACATCAACAGATTCGTGTTTTACATTGGCTGCGCAAGCTGCGTAGCCAACCCACCACTAACCCCACTTGGCTAAAAAGTG
TGCTGGAGTATGCCAACGTACTGCTTCACATGCTACTCGAAGGTGTACGTGCCTTTGATCGCTGTTGTGTTTTGACGATATTCACAACCATACTATGCTC
AGGTGATCGAGGAACCTTTTACAAAAATGCCACCCCAAGGTCCATTGGCAGCACTTCCGAGATATCAAGTAAGACTTCGTATGATATCATTTACTTTGTC
TTGCTTTCGCTCTTGGGGCCTGAGTATTTGTTTGGTGATGTAGGTTGCACGTCTAACAAAGGCAGCAAAACGTCTCGCTCGGTCGTCGGCAGCTCGACCA
AAGCCAACTCAATATTCAAGTTGTCATCCCGACCTTAACTCAATAACCTGTAGCAACAACTCTGAAGAATCCGTACGGGCTGTGGTGGTAGTTGAAAAAG
CGAGCAAACAGATCCAGACCCAAGAACAAGACGATCAGTGGGAATGGCAACGCGTCTGGAAAGGAGCATTCGACAAAATGCGTCACCAATTGCAAGTAAC
AACCGAGGAGACGGAGGCGCTATCCTTCGAGAACAAGGTATGCTCTCAGTATCCTTTAGACTTCACTCATGGCTGAGCTGTTGTGTCTGTCTAGGAGTTG
CGTGCTCTCGTAGCAGGGTACAAGAAAACTCTGGATGAAGCTGAACGGAACCAGCGTGAACTTGAATCCAAACACCTCGCCGAGATCGAGAATCTCCGTA
CTGTGCACTCCCTAGAACTCTCAGATCTGCAATCAAGACACCGTCAAAAACTCCAGGAGGTGGCGCTACAGAACGACGAAAAATTGTTCAGCAGACGACG
AGAAAATCGATTTGTCTCCACGGTGCGTAGTTTTACACTCTCATCATGACATGCTCTGGCTAATATCCCTATTGCAACAGACCCAAGACGCTAACTCGGA
CTTTCTCCAATATATCGACGACTTCTACTCATCCACCTTACATCTCACTGCGCAAAATAGAGTCTGACGAAATAGAGTACTCTATAAAACGCTATATACA
GCTTTAGGGTCATTTTGGGAAAGACAAGACAAGAATGAGCACGGTCTTACAGGGAGATCCGCGCCGCCCCGGCGACTTGCATCCATTCGTGCGCGAACAG
GTGGACCCAGACGACGCCCCCGGCGACTGGTACGCTTTCTTCTCGCTCGTGTTGGGCTTCCTCGCGTTCACCATGAAGGTGCGTCATCTCCTTATCGCTA
TACTTGGCGGTGATAGCTAATACTCCTGATGTATACGTAGTGGAAGGAATTGGCGTGGGGTTCGCTGCTGCTCTGCGTAGGCTCGTTTACCAACATGAAG
TCGCAGGATATGAACATGACGCAGGTTGCCATGTCCTTCTTCTTCTCCACTTCGGCCCTCGTGTCCGCCTATATGGGGGCCATGCGTCCGGGCATGCCCA
TGCCGTCCGCCCAGATGGTCGAAGCCCCAGCTTCGTAGAGAAGAAGCTATAGGGAGAGTATATCCAGCAGGTCCAGAGGCTGTAACAATGGACGTTGGTA
CTGTGCTTTGATGTTTGAGTTGTGCATTACTGGGTAACGACCAGTGGTGAGTGCTATTTAGGAC