Description :
From Genome Similarity Track
Location :
Scaffold_974:6772- 7970
Sequence
1198 bases(100 bases per row)
CGACGAAGCGTAGAACAGCTAGCTCCCCCAGCAGGAAAACAGTCCCCTCCTCGCCACGGATGTCCCCTTCAGGCCGAATGTATATATATCGAGGGTCGAG
ACTTCGACCTGACGGTGGCCTGGAAGTCCAACCTGCTTTTATCAGTCTTGCCCACGTCTGTCGAAACGAACTTGTGTCCCCCAGACTCCTCGCTGTATCT
GTAGAACTTGTGTCGCGGTTAGAAGTCCGAGAgaggcggcgacgcttcCTGGTAACTGACGATGCAGTCGCTTCATGTCCCCGCTTGCCTCCACCATCAG
CCGGCTGCGCCATTCCCTCTATTTTTGATTGTGAGGCTTAAGCGGGGGCTCCAATGCGTCGTCACGTCGTTCTAATATATGAAGGTACTTTAGTAGTACT
CGTCTACCAATCAACACATTTTATAGTTATTATGTTGTAGACATTATTAAATTAAATGAGGTTCACATTAGCCAACCAAACATGGGCGGCAAATTTTGGC
GACAAATCATGCTATACTGATTTTCTCTGTCATATACAAATACCAGCATCAATGCACACATTCGAAACTGCCGTAGGTAAAGGCAGAAACGCGCGATACG
CGCTGAGTAGCAAAGTGGCTTGGGCAATGGTGAACAGCCTGCTTGACAACGCTAATCCGTGCAAGAGGCACATGCTTATAGATTTACGTGCGCAGCTAAG
CGTTGGGAAAGACGCGGGCAGGTTAGAGGGAGCCGATGCGCGCCTAGGGCTTTCGCGCCATTACATATCATTTCATTTCATTCCATTAGATAATGGCACG
AAAGCCGCCGCGCCATCACGCGCACGTGAACGGGCATCATCATGCCGCCAACGCTGGCGCGTCATCGTTCATAAATGGGTTTGAGTGGTAAGTGATTGGC
AAACTATTTTTCATTACGGCATAATTTACCGCGTCGGGAACGCCGTTTGAATTGTCATTGTCCAATCAGAGGCACACAAGCTGTTATCGGGCATCAAGCA
GCCTCATTATCCAATCAGAATGCGACCTAAAAGGGCGCTCCATGCGCCCTTTTACGTTGCTATCTAGCAGTTAGCAATGCATCGAGTGTGATTTGTATGC
GTGTCCTGTCCTAAAAAGGCGCATGGTGCGCCCTTTTCGTTTGAATTCATGTAActttgtatactatagtttacaCATGTgactcgcgaaagggttaa