Description :
From Genome Similarity Track
Location :
scaffold_81:67717- 69171
Transcript NameFunction/comments
Pl_110246hypothetical protein PHYSODRAFT_482921

Sequence
1454 bases(100 bases per row)
TACTCCGCAGTCTTGGATTTCTTTTTGTTCTTCTTGGACTTCTTCTCCTTCTTGGACTTCTTGGCGGGGGCCTCCTCAACCTCCTCCATTTCAACATCCT
CCTCAACCGGGCGCTTCTTCGACTTCTTGTCCTTCTTAGACTTCTTCTCAGACTTCGTAGCAGCCTTCTTAAGCTCATCAGACACCTCCTGCATCACGTC
AGCGTTCTTACGGGGAGCGGCACCGCTCTCGTAGAAAGCAAGACGCTCCTCAACCTGTTCACGCATCTTGTCACCGTACTTCGTCGTGGGCTCATCAATA
AACGAGTCGATACGGGAAGCAATAGCGCACTTGTTGGCAAGGTAACGCGAGATACGGCCCTTGTTCTTTGCAGCAGCGCGACCAATGAAGGTGGAGTGGA
ACAGCAGACCGTACTTGGGGGTGTTGCCGCGAGTCTTCAGAGCGCGGAACAGAGCCTTCTCAGCACCCAGGATCTGCACCGTCGAGGCGGGGCACTTGGC
CAGGTTGGTCAGCGAACCAGCGTGTGAAATGAGACGAGCACCCACGGCCTCACCAATGAGCGAGGCAAGGTTGGGAGCCACCGTCGACATCTTGGACACC
AGGTACTCGTGCAGCTGGCGACGGTACTCAGCAAGCTTCACAAGACGTGTGGTGAAGTTGTCCACGTTGATCATATCAATCTCCGACATGTCCATACCCA
TGGAGGAGCGAGCGGCGTGCAGGATCTGCTGAGCCTTGTCCTCGTCTAGAACGATCTTGGCAAGCTCCTCGAGCGAGTCCTCACTGAGTGTGCTACGGTT
CTTAATGAACGAAGCACAACGAGCATACACGTAGTTGTCATTGACAATCTTGACCAACTCCGGGAAGTGCCATGAGTACCACTCACGCACGCGCATGGCA
AACGTGTTGATGTCCTTGTCCATCTGGTCAAGCAGTGCAATAGCCTGGATGATCATGTTGTCAGCACGGTTCACGTTGAATTTGACCTTGGCACGCGAGT
ACGAGTGACCAAGACCGAGCTGAGCCTTGGCCAAGTTGCCGTGGGCCAGCTCCTTGACGAATGTGGCGAAGTGCATGCGCACACCGCGCACGATCTCGAG
CGTCGTCTCGCTCGTGTTGCACGGGGCGTTGAGCTCGTCCGAGATGGCCTGAGCCAGTCCCTTGTCCTGCACACCCAGGGCGAACTTGGCCTTCTTGCCG
GCCTTGACCTTGGGCAGGTTCATCTCCAGGAAGTTCTTGAGGTCGTCGCCCACGAGACCTTCGGACACGTTGTTGATGTTCTCGAGGGCGTTCTCAGCCG
ACGTGAAGGGCTGGAAAGCCTTGAGCTTCACGATGCGTCCGAACGAAGACACGTCCGCAACGGCAGCCTGCACTTCAGCCAGGAGTCCGCCGATCTCCTC
GTTCTCCACTACTTCAAAGATTGCATAGCCTGAAGCTGACTCGAACAGCACAAA