Description :
From Genome Similarity Track
Location :
Scaffold_114:67664- 69717
Sequence
2053 bases(100 bases per row)
GGCAGGTATGCTGCACGAGGGTGTATTCCTGCAATTTACAATGAAATCATGGATTATAAGACCCAATTCCAAGTGGCACCTTTTTCGTGCTTAACATAAT
TTTGATGTGGCCACTGTCCTTGCACAGTCGCTAATCTCTAGGAAGTGTGTTCTCTAGAGCAATATGCTGGGCAGTATCACGTGCAGCGTACTCGACTAAG
TTGATTGGTGTTACCAATTTATTATGGGAGCGAGCAATATTTCGCCTAAAGACCTAAGGACACTAAACTATATTATCTGAGAGTGGCTAGTTATGCCTTT
GAAATGTCGGCTACATTTTATCGTCTAGTGACTAAGCCGTTATACCCTCATAGGGCTTACGCACGGAATAACACTAAGTACATTTTTGTACGTAGTCTTA
TGGGACTGAAAAGGTCAGATGTGGAAAAATTTATAGATCATTTACGACCGGTGATCAAGTGCATGCGAACGTACATGCTGTAAAATAATGCATTAAAGTG
CATATTTGGTTCAGTTTGAATTCCCCTTTTCTAGGGTGCTTTATTATAAAAATACGGCCTTCGAGCATACTCCTCAAAATAAAGCCATCGCGAATTGGCA
GTTTCCCCTTAGGAACAAAAGGGATTATGTTAATGGCTTAGACTTGCCGATTACTTGCACAAGTAATGTTAGCGATATGCTGATATGGATCGGCCATTAT
CAAAAAGTTTAACAATTACATAGGTTGCTGTTGGGACACCTAACATGATAAATTAGTGTCGTTTATGACGAGTCTGATTTTGCCACATGTAGTGCAGTGT
AACAAACAGAAGTTTATAAAGATCTCGCGCAAATAAATTTGAATCTTTTTAGCTAAAAGCTACGGAAAAAACTTTTCATTTCTTGACAAAGATTCACTGG
CGATGAAGTATGCTCACTAAAAATTCAGGGCTCGACGTCTTGGCTCAAATTCTTTCGTGGCCTGCATAGATCATGTTTACTTCCGCACTGCAACTTATTG
GTCTCATTTTCACTAAAAAAAAGACGGCTGGGTTCCGTTCTCTGCTGGCTATAACTTCGAGGTGACGTGAAATCGTTGTAAGCCAAATGGTATGGCGAAT
GCATTGTCATGCCGAACTAATTATGAGCTTGATAATTTAACGACATTGTCGTCGTTTATCAAGAATTACATTTGAGCCGCATTAGAAAACGGTAAATTAT
GTATAGCTTTGCTACGTGTCCTCGGCAGTGGTTTCTTGAAAAATCATACATTAAGTTGTCGGGACGATTACGTGCAAGCCCCTATCGATATTTTATCGAT
CAGGAGCTGTTGTAATATGCGCATATATTTGCGATACTACTATTTATACTAATTCCTTATAATTTGGATTTCAAATACATCAACCTCTACGAGACATATG
ACAGTGCCATTAGCAGCCATTCGGGTCATGAAAATACTTATGGGTCGGTAGGCCAACGCTACTGGTGACCTTAAAAATCTACAAATGGGTGAATACACCC
TGTGAGTACGTGCCAAATTTTTAAACGGATTAAACCATCAGTCTATACATCGTAGCGCTGGTTAGATTGTCTAGTATCCCCACTGGATTTTAAAGTTTTA
TTAGTATGTACTTAGCGATCGGCCTGTCGAAATATTCGAACGGATACGCGATGATATTTGCTGACGGTTTGATCAACATATTGTACGTAGCGGCTGTGAC
ATGACTGATGAATGGTCACGTTATAGTGGAGCTGTTTACTGATAGATTGTTTTGTCAACATTGCCCACCTGTGGCAATTGTAACTTATAGAGACCCTAAT
TTCAACAAGTGGCTTTTGACAGTCCATCTTTCAAGTGCGTGTCACACGATGTATATGTCTAAAGCGGATATTATGTAGACCGCTTGTGAATTGAATGCGT
CAACCGCGTTCTTGAAGACATTCTAAGCGGCATTTATGATGATACGACTCTGCGTTAGAGCTCAATGCTTCCTGTTGTCGACTGTGAGTTAAATAGCTAT
GAACACATCTATACTGGCTATACTTCGTTCTATGTGAACGGCCTTACGAAATC