Description :
From Genome Similarity Track
Location :
Scaffold_265:67659- 69598
Transcript NameFunction/comments
Aphin_H310_08852Hypothetical protein

Sequence
1939 bases(100 bases per row)
ACAACAGCGACGATAGTGACACGACGGCATGGGACGATGCATTCGCTTGCGTGGACGTCGGGCCGAAGACGGCATACATGGACGTCGACGAGTGCTTGAT
CGCGCCTAGCAGCGGCAGGACATTCGCATGCTGCAGCGACGCCAGGAGCGGCAGGCGTTGCACAAACATGCGACTGCCCACCGACGTCGCAAGGTTGTCG
GTGGCCTCTGCATCCGCCATGACAGCGATCTCGAGTTTCTGAACGAGAACGCGGACCGAATTGTTGTATTCAGCTGTGAAGAACCCGCACGCCGACTTCT
TGAGGTGCCGCAGTTCCGTCCGTTGTAGTACAGCATAGCCCTGTCGTGCATCGAGGGGGAACTGGGTCGCATCGTACGGCGCAGATGACGTTGCCGTCGC
GACGAAGCGGGGCGGCGTCACGGGGTCCGACTTGTACTCGCCCGTGGTGGCGTCGTCTTCACAGGCGGAGCTCGTGCGCCGGGACATTTCCCGACCGAGC
AGCGGGGCTGACTTCCGCCGACGGCGGCGGTGAAGTATGGCAAACCCAAGGATGGCGAGGACAGCACACGCCGCCGCAACGCCTGCCACGATGCCCCCGA
TGTTGGACGAGATGTCGGTGGACGTTGTCGGGGTCGGTTGAGACGTTGCGATGGTCGACGTGGGGGTCGTCGGGGGTGGTGTCCCCGGCAATTGGATGAG
AAAGGAGCGCAAAGTTGACTCGCTGATGCCTGATACTGTCGACGCGTCGATGGGATTTCGTCTCAAGTCGCTGCACGAACATGTCAAGTTTCGGTGACAT
GTACGAGGACAAGTGTACATGGAAATCGGCGTGCCAGATTCAACCAACTTGATCAACGACGCCGGGATTTCCGTAAATTGGTTGCCGGACAAGTCACTAG
GACATGCCGCATGCGACGTCAACGATGAGGGACGGCGTCGACGGAAGCGTACATGAGTTTGAGCTGGGATGTGGACCTCAAGTCGAGCGAAAACGCATTG
GTGAGGTTGCTGGCTGTGATGGCGAGCGTCGTGAGCTGCGGCACGTCGATGGAGAGACCCGCAGCAGGCACAGTGCACCGGTCGATGAATCTAAGGCCAA
GAACGAGGCGTCGTAAACGAGGCAAGATGCTGTCGATTGCTCGTACAAGGTGACGAGGGATGTGGGAAGGACGATTGTTGAGGAATGCTGCGCCGCGTTC
ACGTTCGTAAGGTTCCTGCATAACATTGATCGTATGTCCATGTCGATCTGGGCTTACAAAGATTCGAGACGCGCAAGTGTCGCGACCGCGCTGAAGCGGA
AGTTAAAGCTGCGTGAGGACGGACTGCCCTTGATTGTTCTACAGGAACTCGACGGTAAGCATGGGTGCCTGGACAAAGTTGAAATTCGTACAATGCCGTG
ATGAGTTGTGGCGCTTTCGGGCCGACATTCCCGAGCTCTGCAAAGTTTCCTGTAAATGTCACGACGCTGTCTGTCGTCGTCGCGCCGGCATTGTCGGTGG
CATCGGCAATGTCAATCTGGACTGTGGATTGTACCTCCACGCACTTGTAGTTGCCAATCGTACACTGGGCGCACCACTGGCTTTCGTAGAGGGATGGTAC
GTTCACAGCAAGTGTCACTCCTTTGCCGCATGGAGCCGACGGCACGTCGTAGCCACGTGCGACAGAAAGGCCAAGAAGCAGCACGAGACTCTTCATGGAT
AGCACGTTGCCGATGCGTTCTCGTGCACGTCAGAGCCAAGACTTGGGCGGCGGTGGTGGCGCTCGCTCGTCCACGACCCCTCGCCTTGTTTAATGCATGC
GTTGAACAAAAAAGAATCCATATTTCGATAAAAAATACATTGATAGCTTGAGAATACATACAAAAATGAAGTTCTTTTCGTCGAACGGCGGTGATATCGA
TTTAAAATCCCAATCCAGGAGTTACACGTCCGTTGTGAA