Description :
From Genome Similarity Track
Location :
contig_8:67659- 69352
Transcript NameFunction/comments
g1799.t1hypothetical protein

Sequence
1693 bases(100 bases per row)
TCTGGGATGAGCGTCCGCGCAAGTACAAGAACGTGCTGTTCCAGGTGTGCGTCTTCATCCTCATGATGGAGCTGTCGGAGCGTCTCAGCTACTACGGCAT
CAACCAAGGCCTCAAGAACTTCATGCAGAAGATCGGCTGGAGCCTCGTGTCCGCCAGCGCCTTGAAGAGCACGTGGACGTCCATCTGCTACATCACGCCG
CTGTTCGGCGCGTACCTGGCCGACGAGAAGTGGGGTCGCTTCCGCACCATCCTGACCTTCGGTGTTTGGTACTGCGTGGGCGACTTCCTCGTGGCCATCG
CGGCTCACCCGGACATCATGACGGAGGAGGCCATCGTGAACCCAATCTTCGTTATCGGCTTGTTCGTGGGCATCGGCGTCGGAACGGGTGCCATCAAGTC
CAACGTGATCACGTTCGGAGCCGACCAGTTCGACCCGAACGACCCGAGTGAAGTGCACCAGAAGGCGACGTACTTCTCCTACTTCTACTTCTGCATCAAC
TTCGGCGCCGCCTTCTCGTACGGATACCTGTCGGTGCTGTGCGTTGACGGCTCTGCTCAGATCCCTGCCGAGTACGGCTACTTCGCCACCTACATGATCT
GTGCGGCGGTGATGGTCGTGGCCATCGTCTTCTTCATCATTGGCTCGCCGCGCTACGTGCACATGCCGCCCAAGGACCGCACGATCTCGACGCTGCTGCG
TCTGCTCAAGCAGAGTGCACGCACGTCTCGCAACGGTGCGCTTGTCGTCACTGGTGCGCTGCTGCTCTTGTTCTCGCTGGCCGTCAACATCGCGTCGGCT
TTCAGTGCCGACAGCGGTCGCGTGGGCGAAGCGCTCTCGTACGTGGCAGCTGCTATGGTGCTGAGCGGCGTGGTGTGCTGGGTGGTCGGCGCGCACGACC
AGTCCTTCCTGGACGTCATGAAGGAGAGCCACGGAGGCGAGTACGACGACGAGCTCGTGGACGGCTACAAGAAGCTCGTGAGCACGCTACCGTTCGCCGC
CTACACCATCATCTGGCAGTGCGCGTACGACCAAACGGACGCCAACTTCCAGTCGATCACGCAGCAGTGCGACCTGCGGCTGACCGCAGCGACCCGGACA
GCTCGCAGATCCCCGGCGCCATGCTCGGCGTCTTCGACCCGATCTTCATCGTCATCTGCATCCCCATCCTGGACTCGGTCGTGTACCCCATGTACGAGAA
GCGGTTCGGCAAGGCTCCGAGCCACTTCGGCCGAGTCTGCGCGGGGCTCATCGTGGCGGCCGTCGGCATCTTCTGGTCGGGCATCTTCGAGTCCATCCGC
CGCAACGCTGGAGCGCTGCAGGACGCCAACGGAGACCCGATCCTGGACGGGGGCAGTAGCCAGCCCATGAACGACATCACGTGGGCTGCGGCCATCCCCA
ACTACGTCTTCATCGCCATGGCCGAGTGCCTCATCAACGTCACGGCCTACGACGTCTTCTACTCGGTCGTGCCGCTCACGCTCAAGAGCACGTCGCAGAG
CGTCAACCTCTTCATGACGTCCGTGGGCAGCGTCATGACGTCGGTCTTCACCGTCATGTTCTCGCCCTACCTCCCGTCGGACGACCTCAACGACGGCCAT
CTCGAGTACATGTTTTACGCGGTGGGCGCCGTCAGCGTCGTCAACTTCTTCGCCTTCTACTTCACGATGAAGAAGATGAACTTCGGCATGTCC