Description :
From Genome Similarity Track
Location :
Scaffold_265:67658- 69590
Transcript NameFunction/comments
Aphin_H310_08852Hypothetical protein

Sequence
1932 bases(100 bases per row)
TACAACAGCGACGATAGTGACACGACGGCATGGGACGATGCATTCGCTTGCGTGGACGTCGGGCCGAAGACGGCATACATGGACGTCGACGAGTGCTTGA
TCGCGCCTAGCAGCGGCAGGACATTCGCATGCTGCAGCGACGCCAGGAGCGGCAGGCGTTGCACAAACATGCGACTGCCCACCGACGTCGCAAGGTTGTC
GGTGGCCTCTGCATCCGCCATGACAGCGATCTCGAGTTTCTGAACGAGAACGCGGACCGAATTGTTGTATTCAGCTGTGAAGAACCCGCACGCCGACTTC
TTGAGGTGCCGCAGTTCCGTCCGTTGTAGTACAGCATAGCCCTGTCGTGCATCGAGGGGGAACTGGGTCGCATCGTACGGCGCAGATGACGTTGCCGTCG
CGACGAAGCGGGGCGGCGTCACGGGGTCCGACTTGTACTCGCCCGTGGTGGCGTCGTCTTCACAGGCGGAGCTCGTGCGCCGGGACATTTCCCGACCGAG
CAGCGGGGCTGACTTCCGCCGACGGCGGCGGTGAAGTATGGCAAACCCAAGGATGGCGAGGACAGCACACGCCGCCGCAACGCCTGCCACGATGCCCCCG
ATGTTGGACGAGATGTCGGTGGACGTTGTCGGGGTCGGTTGAGACGTTGCGATGGTCGACGTGGGGGTCGTCGGGGGTGGTGTCCCCGGCAATTGGATGA
GAAAGGAGCGCAAAGTTGACTCGCTGATGCCTGATACTGTCGACGCGTCGATGGGATTTCGTCTCAAGTCGCTGCACGAACATGTCAAGTTTCGGTGACA
TGTACGAGGACAAGTGTACATGGAAATCGGCGTGCCAGATTCAACCAACTTGATCAACGACGCCGGGATTTCCGTAAATTGGTTGCCGGACAAGTCACTA
GGACATGCCGCATGCGACGTCAACGATGAGGGACGGCGTCGACGGAAGCGTACATGAGTTTGAGCTGGGATGTGGACCTCAAGTCGAGCGAAAACGCATT
GGTGAGGTTGCTGGCTGTGATGGCGAGCGTCGTGAGCTGCGGCACGTCGATGGAGAGACCCGCAGCAGGCACAGTGCACCGGTCGATGAATCTAAGGCCA
AGAACGAGGCGTCGTAAACGAGGCAAGATGCTGTCGATTGCTCGTACAAGGTGACGAGGGATGTGGGAAGGACGATTGTTGAGGAATGCTGCGCCGCGTT
CACGTTCGTAAGGTTCCTGCATAACATTGATCGTATGTCCATGTCGATCTGGGCTTACAAAGATTCGAGACGCGCAAGTGTCGCGACCGCGCTGAAGCGG
AAGTTAAAGCTGCGTGAGGACGGACTGCCCTTGATTGTTCTACAGGAACTCGACGGTAAGCATGGGTGCCTGGACAAAGTTGAAATTCGTACAATGCCGT
GATGAGTTGTGGCGCTTTCGGGCCGACATTCCCGAGCTCTGCAAAGTTTCCTGTAAATGTCACGACGCTGTCTGTCGTCGTCGCGCCGGCATTGTCGGTG
GCATCGGCAATGTCAATCTGGACTGTGGATTGTACCTCCACGCACTTGTAGTTGCCAATCGTACACTGGGCGCACCACTGGCTTTCGTAGAGGGATGGTA
CGTTCACAGCAAGTGTCACTCCTTTGCCGCATGGAGCCGACGGCACGTCGTAGCCACGTGCGACAGAAAGGCCAAGAAGCAGCACGAGACTCTTCATGGA
TAGCACGTTGCCGATGCGTTCTCGTGCACGTCAGAGCCAAGACTTGGGCGGCGGTGGTGGCGCTCGCTCGTCCACGACCCCTCGCCTTGTTTAATGCATG
CGTTGAACAAAAAAGAATCCATATTTCGATAAAAAATACATTGATAGCTTGAGAATACATACAAAAATGAAGTTCTTTTCGTCGAACGGCGGTGATATCG
ATTTAAAATCCCAATCCAGGAGTTACACGTCC