Description :
From Genome Similarity Track
Location :
Scaffold_19:67639- 69797
Transcript NameFunction/comments
Hyaar_Emoy2803278hypothetical protein

Sequence
2158 bases(100 bases per row)
CGAAGCAGAAGGAACAGCCATGGTGTCGCAGGCAAACAATTTTCTGATAGACAACTGCTATCAATTGTCGCAGAGATTTGCGGGATTTGAAAAATTGCAA
AGGAATGTTTTCCATGTAACTCTAAAGACGCCTATATTTAGGCAAATGCTAAGCGGCTGGGTTCATTTGTTATTCGGCCTGATCATTATATATGCTTTTA
AAGGAGTAACCCAGAAGTACGCCTAATTTGGGCAGGAATAGATCCCAAGATGATTCAATTTGGTATTAAAACTTACTTACTTGTCAGTGCAAAGCTCGAA
ACGACGATAACTTATTAGTGCAGTCCAAGGCTATCATCCTTCTCTAGTCCTCATTCTTTTCTGTTGGCGCTCTCTACTCAGAAAAATGTCGCATAACACC
AAGCCTTATATTCAACCACGTCCATTAAAGCATGATGCATCGGCGCAATCGCGATCGCTCGTAAGGGGCGGTCTCACACGCCTAAGGTTTTTAGTGGCGC
TCTTTAAAAAATATCAAATACGATAGCGATTAACGAGATTCAGTATTGTTGGATTCGCCACAGTCGGCTCAACAATCGAAAATGCGAGATGTAAAATTAA
ACACGCGCGTTAGTGATCGCAGTTGAGTCGCCAACAAGAATTAACCGTACAATGTTTGTGGAACGCGGAGCTGTCTTGAGAATCCCCATGTAGCTAGTCG
GTCACTAAAAGTCACGTTTTGAGGGAAACTATTCATATGTCGAAACAGCAACATGAATTTTTAACGACATACCTAAAAATGACCCAGCCGAATAAAATGA
ACCCAGCCGTTTAGCATTTGCCTATATTTATTGCTAAATTCACCTAGATGCCGTTATGGCTATCCAATTATCTTACATGTACTATCATCAAAAGCTTAGA
AGGCATTCACACATTAGCGAGATTTTATCATATATCTCGCCAGAGAACATCCTTTTTTTAAAACCCGTTGCTTTATATTACACTAATTTCCTTCATTTAG
CAGGATTCACAACATCACATTGTCTTACATCTTTTCAGTTCGGAGTATTCCATTCGCGACAGCGCAAGGGCATGCCCGCAGCATGAAGGTAAATATTACA
CCGAAACGGATGGAGGCAAAATTGTTGTGGGGTCGATAGGCTAGGGCCTCCGCATTTTTATTCTTCACAGAGCCTTTAAGTTTGCTTATAAGACGATGTT
GTGGCATCACTTGCTCTCGTAAAGTTCTTAACATTTATGTCCTTGAAATGGTTCAGTGAAACCTAGCACTTTGAAAGTAGGTATGACAGGGTTTAAATTG
CATTTTAGTGCGCACATATCCGTGAAGCAGCTTCACAATCATGCATCTTGACAACCGTGACCTCCATGTTGTCTTCTTCTCTTGGCACACGCCGCCCAAC
TGGTCCAACCGATTTTATCTTGTTTGTGCATTAGAGGTGGCCAGTGTCGCAGTTGTCGAAAAAAGTGTCAACTGGGCTCTATCGTATGGCACGTTCTTGT
CAAAGATAATCGCGATCTTATACGAACAGCCAACCTTTTAGTTCCGCAGTCTTGTAAGGGCATCATAAGTCCTTGGAAATCCTGATGTCATTTTCTTTGC
GAGCAACAGAGAAAAATGTACTCGGTGCAGGGCGATCTTGTGTGGATACTGCTTATAGAAAAACCTTGGCGCACGGCGTCCTCTTGAGTCCGGAACACGC
TTTTCTTGACTTCCGGATAGACCGACTGGAAGAGGGTCTTTAAAATCCATGATTGAGTGGTCGCATCATTAATAGTGTATACAGCGGCATAAGTGGTAGT
GTCAAGACTACCGGATGAGACTTTCGCAGTAGCCACAGAAGTATCAACATCGTAAGCAACACCACCAGAGGTAAAGATTAGATGTTTTAAATACAATGTT
GACAATGTAGTTATAAAGATGGAAACGGAGGCCTGACTGAGACCAAATAATGGACTCTCTTGGTATAATGTGCATGTTTTCTTAACATTTGCTGACATAG
TTTACATAAGTCAAATGGATAGCCTATGTGGCCTGTGTTGGTGGAAGGTGATGCGACGTATTCGCGCGTGTACGTATTTGGTGTATCTGAAGTTAACCCT
TCGGGTACTGGTGTTTCGGGTTCACCAGCACTTTCCTGCCAGGCAGTGACGTCACCCA