Description :
From Genome Similarity Track
Location :
Scaffold_57:67634- 70904
Transcript NameFunction/comments
Sapdi_VS20SDRG_13184hypothetical protein

Sequence
3270 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCAACGGTATCGGAAGGCCCATCGAACGTA
CAATGATGAGGTCGTGAATAAATCACGGTTGCTGTGAATGGCGTTATCACGTGTGAGAACTGGTGAAAACCACATGTCTTTCGCGCCATTCGACATTCTC
GTCGCTATCGCATGCAGTCATTGACGCACGAGTCGCGAGAGATTGCTGGGAATTCGCGCAAAACCGACGCTTCGTTTCTTTCGAATAACGTTATTTCGAA
GGCGACCAGAGAGCGCCCATCTCGTGGCCACAATTTGCAGTGGTGATGGGTTCAGCCAGCATGTGCAAGTCCCATTCCGCCCCGCCTGTCCCGAATCTGG
GGCGACCAGTCGCGCGACAAACGAAGACGCGCGATCATTCCGCACGACGCGCCGCAGCGACGCGACTCTGGCCAGTACTTCTTCGCACTCGCTTTGGGTT
CCGCCGAGCGCGGCTCTCTTCAAGATGGTGACAACCGAAGATACCGTGCAACTTCGATTCGAATCTTGCATTGTCTGCTACATCGAAGCAAATTCAATCG
AAGTTTTGCGCGGTGACAGGCATCAAAATTTGAACCCGCTCAGTTTGCATTTTGCCATGGTCGGGATCGCTGCGGTAACGTTACTACTGGCGACGGCAGC
GATGGCGCTCGAGCCCATCGTGATCAAAGGTCAGCGGCTCTTCGGCGCCGTCTCGGGCGCGCCGTTCATTGTCGAAGGCATCAACTACTACCCGCGGCCC
AACGCCGGCATCAACGACAAGAACAGCGTCGACTTTTTCACCGACGACCAGAGTGCAATGTGGCTGCCGCACGTGGCCGCGTTCGAAGCCCTTAACGTCA
ACGTCGTGCGCCTCTACTCGGTGGACCCGACCAAGCCCCACGACAAGTTTATGTGCGCGCTCGCTTCGGCCGGCATCTACGTCATGATTGAGCTCGCGTC
GAGCTGTCCAGGCTGCGAGATCACGTCCGAAGCCTACCCCGCGTGTTACCCGCCGTCGCTCAAGACACGCGGGCAACAAATCATCGCCGCGTTCTCCAAG
TACAACAATGTCCTTGTACGTCCAGACAATAATCCCTTCCTCTCGCTCAATATGTTGCTGGCTAGGGGTTTAGCGCTGGCAACGAAGTCAACCACCGCAC
CAAAGACATCAAGTCGAACGCGCCGTGTCAAAAGAAGTTTATTCGCGACATGCGCGCGTTCACGACCGCCTGCCGGGGCTCGATGCGGCAAGTGCCCATC
GGTATTGCCGTCGCCGACGCCGAACGCTCGGCCAACGCACTGTACTACAGTTGCCGCACCGACCCGGCCGACCCACTCGAAGACATCGAATGTACCAATC
TGTCTTCTTTGACCAGCTCTAACGCCTGCACTAGGGTATGGCCTCAACGTCTACTTGCAGTGCGACCCGAAAGCAACTACGGCCGTCGAAGGCCCCGGAT
ACAATGAGCTCAAGACGCAGCTCAACTCGTACAAGATGGTGGCGCCTGTGATTTTGACGGAATTTGGCTGCTTGAACAAGGGTTTCCCGACCATCGACGG
GTACGCGGCCCAGCGCACGTGGGTTCAAGTCCCGTGGATTCGCAAGGACCCCGATGTCCTGGCTGGCGGCGTCGCATTCGAGTTTTCGACCGAGAACGCC
AACTCGATGGCCGACGCGCCATACCCGTTCACGTCGTACGGCGCACAGAACTACGGGCTCGGGTACTTTTCCCCAGCCACGTGCAACCACGGCAGTGTGC
CCTGCGTCTACAACGAGATGCCCAACTTTAAGAGTCTGGCGCAGCAATACGCGTCGCGCGCCCGCTCGATCAACGGACTCCCTTCCAAGGATCAGTACAC
GGCGCTTCGGACGCAGCCGCCAGCATGTCCGACGGGCTTTGCTGCTCTCAAGACGATCACGTGGGCTCCGGACGCCGCACCGAACCTCCAGTGCCCCAAC
TACACGCAGGTGGCTGCGTGCCCCGGCGAGAGCCCCGGCGTCGGACATCTCGATGGAAGTTTGAACAGCA