Description :
From Genome Similarity Track
Location :
Scaffold_62:67613- 69218
Sequence
1605 bases(100 bases per row)
GTTCTCGGGCATAGCCCAGAGGTATCCCCAAATAGGATAGAGACCACCCCGGGTCTCGGGCTTCTTACGACAAGTCGTGAAGTCCTTAAGAGGGATGCGA
TGTGGCGCGAGAAGCACACACCGAGCAGCCTCCAAGTTGTCAACGAACAACTGTTCTTTCTGATCAAGGGCACGTTCGTAGATGCCCCTAGAAGTGTGAC
CGCCCACAAGGCCACGAGGAGCGACGAGAAGCTCTAAGAAGAGGTCAGCCCCAAAGCTCTCCTCGGGAGGCCAATACCCTCTTGAGTTGATGGCAGCTCC
CTGGCTGACGGGTGCCACCACCGAACCCCCACGCACACGATGGGCAGCTTGGAATTCCTCCTGCTGCTGGTCGAGGTCATTCGAGACCTCCCGGGGCTCA
GCGATAGCATCATCCTCCTCCTCTTCTTTCTCCTTCTTCTCCTCTTCATCCGAGGAGTCGAAGATACTCTGATAGGAGTGTTGAGTCTCCTTCTCCTCGT
GGAGTGGAGACTTAGAGGCTTTACGCTTCTCTGAGGGCTCGGCGCCTTCGGCTTTAGAGGCCTTAGCACGCGCAAGACCCTCGGCAAGCGAGAGACGTTT
GCGAGGATTCTCTTCCTCATCGCCAACGGCTTTGGGAGCGCCTTAGCCTTGACGGCCGGACTCGCAGAGCGCACAGACGATCTGGGACTGTGATCACCTT
GATCACTAGCGAGCGACTGCACGCTGTCATCCTTGTGCTCACTGGGTACTGGGCTGTGCCCTCCCACAGAGCCCGCAGGAGCATCGTACGTGCTCTCGGA
CTCGGCTTCGTCCTCACTGCCAGAGTTGAACTCACGTTCCACGAACCGAGGGTTCGGACGATTGTCTGAGGCCGAGGGCGACGGACTGCGGCGCGTGCTT
GCTTGCTTTCCCACAGCCGCGTCACCCGAGGAACCGATCGCCTCGGAGGCCACCTGAGTAGCCTCCTTGAGTGCAGAGCCTTTGCCGTGAGGCTTAGTGC
TGTTGGCTTGCGCCTTACCGGCCGCAGCCTTGGAGCGTGTCTTAGCACCGCTCTTTGCTGTGCCACGAGGGATGGTAACGTTCGAATTGGAGACCTAGAC
GAATAGCGCACAGGCTGCTGCTCGAGGCTCTAACTGTGAAGTGAGCCTCCGCCGAGCTCGCGCGGCCAAGTCGATGGTTTTCGACTTTGAGAATGAGAGT
TTGTGACGAACACCTCTTCATTCTAATTGGTCGGTATACCTAACCTAAGTGGGGGAGGATGTAACGGGGTACGTAGCCCTAAGTGTACCCTGGTTACATG
AAGTGTGACACTTCACACTTCAGGAGTATGACACGTCATACTCCGGGATATTTGGTACAAAGTACCAAGGTCGTTCAAAGCCAACCATTGGTCAACGACA
TTGCATTTCTATAGGTGACTTATAGTTTGTATTAAACCCAAACTTAACCTACCTATAAATATACTCAGTTTACAATCTACCTTATTTAGGTCACTTCGCT
CTCTTTTAAATAAAGAGGGGACCTGTGAACTGCCATTCACTGAGAGTTTGTATACTCTCGGAAAATAACTTCCTCTAGCGCAAGGTGCTGTGTGACCCCG
TCACA