Description :
From Genome Similarity Track
Location :
Scaffold_633:6761- 10469
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_633-fgenesh-gene-0.2ATP-binding Cassette (ABC) Superfamily

Sequence
3708 bases(100 bases per row)
GTCGCTATTCTACCACACAGAATATGTATGGCACACGCATTGACGGTTGGAACTCTGGTTGCGGGTTGCCGACAAAGGACTGCGAAACAAGGTTGCTCTT
CAGCCATGAACAGTCCTAGCATATCATGATATGAAAGAAGGCCAAAAGCTCCATTTGTGTATAATGCATGAAGATGTTCAACTCCAGCGGAGGCTCGCAT
TTGACTCCACCTCCTGAACTGACTCGCTCGAGAACGAAAGGTTTCGGAGGGAGATTCAGTTCGCCGCCGCCTCGAGAAGCTTCGCGTAGAGCCCGCTCTG
CGCCACTAGCTCCTCGTGCGAGCCTTGCTCGGCGATCTTGCCTCCGCTCACGACACAAATCTTGTCTGCCTTCCGGATCGTCGAGAGGCGGTGGGCAATG
ATGATCGTGGTCCGCCTCTGCAGCGCCACCACCTTGTCCAGCGCCGCCTGCACGATCTTCTCACTCTCCGAATCGAGTGCGCTCGTCGCCTCATCCAGCA
ACAGAATTCGTGGGTTCTTGAGGATAGCGCCCGCAATCGCGATGCGCTGCTTCTGACCGCCTGACAGCTGCTCGCCCTTGTTCCCCACCTGCGTGTCGTA
TCCGTCCGGGAACTGCGAGATGAAGTCGTGTGCGTTCGCCATCTTCGCCGCCGCCTCGATCTCCTTTCGGCTCGGCGTCGACTCGAGACCGTATGCAATG
TTCTCGGCGATTGATCCGATGAACAGCGTCGGCTCTTGACTCACAAGCCCAATTTGACTCCGCAGCCACTGCACATTCAGCTGTTTTGTGTCGACTCCAT
CCAGAAGCACTTGGCCGCGCACAGGATCATAGAACCGCTCGAGCAACGAGATGCACGTACTCTTGCCGCCTCCACTTGGACCACAGAAGGCGACAGTTTG
GCCAGCTTCGATAGTCAGGTTGTAGTGCTTGAGTACCGTTACTTCTGGCCGCGCGGGGTATCGGAACAGCACGTCCTTGAACTCGATCTTGCCGTCGACT
CGCTGTGGTCGGAGTCCGCCGTTGTCGAACGAATCAATCGCAGGCTTGCGATCCCGAAGTCCCATGATGATATCACCGGAGTAAAAGGCGCTGTCCGCGT
CGGTCACATAGGCAATGGACGAACCGATGCTCTCCGAAGACATGATGATTGCCATCAGCGAGCGCAACAGCTGTCGAAACGTGATGTCGCCGTCGTTGAC
CAGCTTGCCGCCGTACCAGAATGTGAACGCATAGGTGGCATACACGACGAAGGAGCAAAAGCCAACTGCGAGGCCGTTCACTTGCGCTTCTTGTTCGCCG
CCTTTCATAGGCACATCGAGTAGTGTGTCAAAGTGGTCGCACAATGTCCGCTCCATACCCAGCGAAATGACCGTGCGAATGTTGTTGAGAACCTCCGAAG
CGTGCGCTCCGACTGCAGTCATATCATTCGACACCAATCGCTTGCCGTGCGCGTGCTTGGACCGGAACACGTTGCCGAAAACCAATACGGGGAGGATGAC
GAGCATGAAGAGCGACAACACCCAACTTCCCGCCACGAAAGAGATGAGAAGCGCCACAACGGTCGTAAAAAACGCCTGGAAGAGCCGACCCTGCGATTCG
CCGGTGATCATTGACACTTGCAGCGAGCAGGTCGCGAGGTCTGCTGTCAGTGCTCCAGTAGCATTCTCTTTGGCATCGAAGAACCCAATATTTTGGCGAC
AGAGCGACGTGAAGTGGATGTCGCGCAGCCGAGTCGTCAGCTTCTCGGCGATGTACTTGAAGCCGTAGCTCTGCATGACGTACCCGATAAACACGATGAC
GGCACCGCCAATGTACAGCCCACCGTAGATCGCAACCTGGTGCGGCAAACCGGACATTGCAGACAGCTGGTGTGACGAAAGATACTTGGAGTATTCGGAC
GTCATCACCACGATGAGTTCACTGGCGAGAACAGCCGACGTCGGGAATGAGGCACCGTTCACTGCCGTTCCGATCATCCCCACAATGTAGTACGCACGCT
CAGGCCTGCTCATCGCGTTCGCCTCTCGTAACGTGAACTTTCCAGTCATGCGCTCCTCCGTACCATCTGCAGTTTCAGCCAGAGCTCCGCCATCGCAGTC
ACTATCAGTGTCGACGCTGCCTGGTGAGTGCCAGCTCTTCTTTCTCGCTGCTCCCGATGCCTTTTGGTGCTGGATCGCTTCCAACGCCAAAGCTGCGACC
TGGGCTTCTTGCTGAGCCTTCTCCTCCTGAGTCATGTACATCTTGCGGTATACTCCGTCTTCAACGGACAGCAGCTTGTCGTGGGAACCCTCCTCCACAA
CATGTCCCTCCGACAGCACAACGATCTTGTCGGAATGGCGAACGGTGCTCAAACGGTGCGCGATCACCAGCGTCGTCATGCTGGTCTTGGCCATCAAGTC
GTTCAGCGCGTTTTGGACCACTCGCTCGCTCTCGGCATCCAGTGCGCTCGTGGCCTCATCCAGTACCAGAATCTTGGGCTCGCGGACAACTGCTCGGGCG
ATGGCAACGCGCTGTTTCTGTCCACCTGACAACGACACTCCCTTCTCCCCAACCATCGTGTCGTAGTTGTCTGGCAGTGACATGATGAATGTGTGCGCGT
TGGCAGACTTGGCCGCCGCAACGACTTGATCCCGTGTGATATCCTTCCGGCCGGCAGCGATGTTGTCCGCTATGGATGTCGCGAATAATACTGGCTCCTG
CGACACCAGTCCGATCTGCGAGCGCAGCCACTTGACGTTGAGCGACTTGATATCGCGTCCGTCGAGAAGGATCGTGCCGTACGTCGGGTCGTAGAAGCGC
TCGAGCAAAGCGATCAGCGTGCTCTTGCCTTGGCCGCTCGCACCGACGAAGGCGACAGTCTGGCCGCTCTCGATGGTGACAGAGTAGTTGCGGAGGACTG
GCGCGTCCGGTCGACTCGGGTACGCAAAGTCAACGTTGACGGCTTCGATCCGGCCTTCACACGATTCAGGGCGATCTCCATCGCCATCGGCAGCGCTGAT
AGCCGACGGCGTGTCTAGCAGTTGGTAGAGAGCCACCGCTGCAGCCTTGGCTTCGATGACCGCAGTCGCGTTCGGGGAGATCTCGCCAAGCGAGCGCGTC
CCCATGATGACAGCCATGAGTGCTTGAAAGACCTCTTGCGGTGAAGCCTCGCCTCGCCACACCTTGGAGCCGCCATACCAAAGACCAGTGCCGTAGATGA
GGAACAAACAGCTCCCAAAGACGCCGCGAGCGATCGAGAAGGTCCAGCTCTGCTTGATGTTGCCCTTCTCCACCTCCGCCGTTCGCTCGTTGTACTTGGC
GATCGCGCGTCGCTCCGCGTTGAGCGAGCTGACCGTCCGGATGGAGCTGAGCGTCTCTTCAGCGACGGCGCCGGCCTCCGCATACAGTTTCTGAGCGCGC
ACGGCTTGGGCACTCCAAGACTTGAGGATGAACATCCACGAAGATGCCATCACCGGCGTCACAACCGTCATGACAAGCGTCACGTCCCAGCCGCGCGTAA
ACCCGATGATGTAACCAGCGACGAACTCGCACACGTACTTGACGGCGTTGCCGAGCTTCTGACCCATACCGTTCTTGATCTTGACCGTGTCACCCGTGAT
GCGACTCGACAGCTGCAGCGCGTCGTGCGCGTCGTACCACGAGACGTCCATGTAGACCATGTGCTCGAGCGCCTTGGCTCGCAGCTTCTTCATCTGTCGC
TCGGCCGA