Description :
From Genome Similarity Track
Location :
Scaffold_1226:676- 2322
Sequence
1646 bases(100 bases per row)
CACCGGCGCGAGCGAGTCTTCCAGGTCAACGAAGCTCGTGATGCTTGACTGCAGTAGCTGCGCAAAGGCGACATCCTTCTCCTTCACGCGCTGCACCTTA
AGATGCCATTGCGATAGCAGCACTGCGAACTGGACCGCGCGTCCGAAGAGAGACTTCGACTTATGCACCCACTCTAACGTCGAGAATCGTGTATAGACAT
GTAGCGTCTTTCCTGCCAGCTGGACGTAACAGATCTTCAACAGATGAAGTAACGCCAAAACTTCCTTCTCAGCTGGATGGTAGTTCATCTCGGCTTCCTT
AAGCACCCGATCGAGGAACCGTACGGGGTGTAACTTGCCTTCATGTTCTTGCATTAGCGTAGTGCTCAACGCCCATTCATTCGCAAAGAGCATGACGTGA
ACCTCTTTCGACCGATCGAAGTGCCTGAGGATGGGTGAATGTGAAACACTCGTCTTCAATTTTTTGAAGGAACGACGTGCCACAGAAAGGCCACCTTCAA
CGACAAAGTCTTCATCCTTGAGCTGGTACAGCGCCGCACCGTAGACCGCGAAGTCTTGAATGAAGCGACTGTAGTAATTAACCGCTCCAAGAAACGACTG
CATGCCCTTCTTGCTCGTTGGAAACGAAAGCTCGGTGATGGCCGCAAGCTTCTTGGGGTCAGCTTTGATGCCTTCTGGCGAAATTTTATGCGACAGAAAG
TCCACCTTGGGTTGGCAGAAGATGCTCTTGGTGAAGCTAATGCTGATCCGACACTGTGCAAATCTTGCCAGCAATCGGTCCAGCGTCGCCAGGCAGCTAT
CGAAATCCTCGCCACCGAAGCAAATGTCATCCACAAACGACCGTCGACCAAATACAGGTACCAACGATGATTCGTCTGGTTCCCCGTTCGTAAACATGTC
AGCGACGGGGCTGTTGACGAGTTGTAGTACAGGGTCGGTCTCTACCGGTACTTCGCGGTCTGCCGCGAGCTTCGTTTGAAACGAACCCTCGGCGCTTGGC
CCACGACGTTCCTTGGCCTGTTCTTCAGCTAAACGCATCCTCTCCGAGTATTCAAACCAACCTCCTTTAGGTTGAACGAACCCCCAGAGTGCGTTGTCAA
TCATACGGTGGTAGATAATCGGCGCGTTCATTAACCCGAAGGGCATGCGTAACCACTCGAAATGTCCGAGTGCGCAGACGAACGCCGACACTTTACGCGC
TCGCAAGGTCATCATGACCGCCCAGAAGCCGCTTGCTGCATCCAGCGAGCAGAACCATACGTAGCGCTCGAGATCTGGTAACAGGTCGTCGAGTAGCGGC
ATTGCATACTCCATAATCGCGGTGATAGCATTCACCATCTTGTAATCAATGCAGAGCCGGATGTCCAGCCCATTCTTTTTCATCACAATCACGATCGGCG
ATGCCAATGGACTGTCTGACAAGACGGTCAGTCCTGCACGCAATAAAGCGCGCAGCAGCTCGTACAGCTTGCCAAGAAATCGTAGCGGTACGCGCCGGGC
ACGCTGTTTTAATTGGGGGCGTGCCCCTGTGTGTCGATATCGCATACCGCACGTTAGCCTGGCCGGCGGCAGTGCGTTTATCACTAGCAATCAGGATGTG
CTCGTGTTTCTTTAGCGTCGCGACAGGACGTTCTCGGCGATCGGTC