Description :
From Genome Similarity Track
Location :
Scaffold_3306:676- 1857
Sequence
1181 bases(100 bases per row)
TCTTCGACGGGCCTTGTCTACAGAGCCTTGGTTTTCGGCTCGGAGTCGCTTGAGGCGACTCCGGTCTGACGTGGCCCCAGACCCAAAGTTTGGCGATGTC
GGTGTCGTTTACGCCGACGACTGGAACGTGGTACTATTTTACCCACGTCTGGTGATGCTTCAACGGCGGCATCAGAGGTCTGGCCGACCTCCTGTGGAAC
TATGTTACCCACACTAGAGGCGCCTCTAGCGACCTCCTCAGCGTTTCTTGCTGGATGCGGAACCATGTTACCCACTGATGGAACTGTGTTGCCCATCCGG
TTAGCACTatccagcgccaccggcGTAGTGGTCTTCACGACCTCACGATGTATTACGTCGGAAGGTGCTGActcagcaccttcttcaggGAGCCTGCCGA
ATACCTGAGCGGCTCCCATAAGCTCTTCAGACGCGTTCGTGTCTCGGCGTGCCTTCCAGGCGCCCTTGTTTCTGGCAGAGGTGGAAATACGACATACCAA
TGCTCTGTCAGAAACTGCGGGCCGGCTGGCCCCGATGGCCTTGCCGCGCCAGTCAATCCAGGGCTCGTGCTTCTCGAGCCACGGCATGCCCAGGATCAAG
TCGTACTTGTCCATACTTAGAGCGAGGAATTGCTCTGTGCTGTCAAAGTCCTCGAACTTGACAGCCAGATCTATGCAGACCTTCGGTACGTCTACCACCG
TACCATCGGCCAGTCTCACGGAGACCAGCCTTTTGCCTTTGCTCTCGCGTAGAGCATCGGCAAACCTGTCGCTATTACCCGCGACTGTCTGGCGGCGTGC
GAAGTTCTTCGACGCCCCAGAGTCGATCAAAACTCGGAAGGGATGATCGTATCCCCGTACACATGCGTGTACTACGAGCAGCCCAccgctgccgttcttc
tGTTCGAGAGTACAGAGACTATCAGGGCTAAGTCTTCATGGTGCGCGCTACCGTGCACCGCTCATGAAGACTTAGGTCTTCCCCAGTAGGGCGCCCCGCC
CCTACTGGTGTCCTGCGTTCCTGCCCCCTGGTCGCGGCTTCTGCCAGCGCCCCTTCAGAGCAAAGGGCTTGGAGGGATATTTCCTCCCTTGTCCTGCAGG
ACAGACACGTTGAATGTGCCCCAGCTTGCCGCAGCCATAGCAGCGAATATTGCTATGCTCGGCCAAGCTCAGGTCCATCGG