Description :
From Genome Similarity Track
Location :
Scaffold_457:6759- 10619
Sequence
3860 bases(100 bases per row)
AGCCTTCTTGTTGACGTGTTGCTGAATTACGATCGAAACCAGCAatgcggacgagctggtaCAGGGTTTTTTGGGACGACTAAAGCTTACTTCTTGTCAA
CTGAATCGCAAAATTCTACTGGGGATCTCCATGGGCACATGCTCATTTGGATTGACGGTATGCCAACAACGGTGGCTGAGTATTACAATATGCTCAAAAG
TGAACGGTGCCAGCAACGgtttaaccctttcgtgagCCACTTGGGTAAACTACagtatacaagtctaagtcatttgattctaaaaAGCCGCAAAACTCGC
CCATTtacaaattcacggtacttcctttgcatatctcGTGTAACATATNTTATAAGAGACggtgtattactaacttgaccttgtgcaaaagggcgcattt
ctcgccctttaagagggcgatttcgtaccgtgttttggaaaacggCTTAAAGGGTGAaaaatgcgcccttgtaccacgaaagggttaagcCGTATGTGTC
TTCAATTGCATCTTCGTCATTTCCAGTCACACCGACAACATGTATGAATTGCTTGTCAAGGGAACGGTGCTCGATGCCAATCGATCAACGCGCTTTTGAA
AGCCCGAAAAGTCTCATTTGCGACCAACAACTGTACGGTGAGCATCCTGCAACAAGACATTTGGTGGGTCGGAATTCGTGGAGTCTGAGATAAGCCATGG
AGCCGAGAGAATACACAAGCCATGCGATATACTAACGGACTCTGTCATTAAGTGCATTATTGTGATGCCGCAGCCACTAAAATGATCACCACAAAGCGAT
ACGGAAACAAAGTTGATAGAAGCTAAAGCACTTCTAAACTACCAAACCCACAGGTGGAACCATGCGAGACCATGCTTCAAGCCCTCCAAACGGACCAAAA
GGTCACATCTGCATAATGTTTTCCCCGAAAGAAGTATGCGTTGAAACAACATGGGACGGCAATGGAACGCTGCACTTGGCACGATCAATCGGAAGTGAAT
ACTTAAACACGTATATGCCTATTATCAACGCTATACTAAAGACGAATCTCGATGTCAAGTTCCTCAGCGCTGGCGAAGGTAAGAAATTTGTGTAAAAGTT
CCCTCGGTGTTACCACGTCTAGCTTCTTCACAAACATTCATTATATAATTGCACTATACACAGGAATTGAAAATGCATTTTTTATAGCACGAAGGCGCAG
AATGTGACCGAGAACCCGATCGCAATTCATACTCACACTTTCAATAAAGCAGTCGCGAAAAACAGTACACTGGCGATGCAATGACGGAAGGAAGACGGAT
AATACAGTCGATGTGTTGCACCTTATCAAACCCCCAAGAAGTATCTAGACCAATGGCAGCATTGTTTGTACTACGAGAATCGCTATTTTATTCATCGTGC
TTTTTTCAAAGCTTTTCTCGGATCCTTTTTGAAAGTACTCTTCAGCGGTCAAACTATGGATGTAATGCTCCACCCAGTTGGCAATGGTGCTACATACCAA
GCATCCAGCCCACTGTAGGACTACATACACAGGCCAGGTCTGCAATCAGATACACATTTGATGAACTTCTTTCGATGGTGGACCAAAAAGCGCGATGTTA
AGGGCTTAAGATTCCATCAAGAACACGCACAACATACTACACACCCAATGTTCAAACGTCCACATCCGGAAACGGTGACGATAGTTGGCTATTGATTTCC
AGACAACAGAAACAGACAACTTCGTGGTGAACAACAAATCAGATTTCAGCGGGCTATGCTACTTTTTTTCTATCCATTTCGCCGCCGTGAAGACATTAGT
CCATCAAAAACAGCCTTGGAACGAATTTTGCCAGACTTGGTGCAACTCGGAAGCACCACAAGTAGCTCGACAGTTTGAAGAAAATGCAATGGATTACTAT
ACGTCACATGTACTAAACAGAACTCGAGTAGATGCAGATACTTTGAAATACAAATCCTGTGTCGAAGTGGGAGGTGATGATAGTGAAGAAACCGTCGGAC
TTggtgagcagctcgaagacgaagatcCTGCCGGTTTCAACCCCGATCTGATGACGCCAGATGGCGATTTACCAGAACTATTGAAGACATTAATCAAGAA
TATATCGCTTCGATCCAAAGCACGTGAATCCGCTTCGCTTGTAGCCCTGTCTAGCGTAGCCCCTCATCAACCCGATGAATTTCCACACTTTAACGGAGGA
GCAGTGGACGACGCATTGCTGAATTGACACAACCCGTGGCGAATATCACGCAAATATCAATTGTCAAAGCGAATCAACCAACAAGCGATGCACCGACACG
AGTGCTAATGTTAAATGATGCATGGGCAGAAGATGAGTGGGATGCCCTTTCAACTGCTAACATGACGGCGCCAATCCCGCTGGAATCACATCCGTCATTA
AGTGCAGTTTCCCAACAGCTTCGGctcaacaagaagcagcacaacaTGTTCATTCACGTAGGTAAATGCTTACTGCAGTCGTTTGACCAAGAATACATTC
CAGATGAAAGCCAAATGGTGGGGTTTCTGATAGGCTTACCGAGATCAGGCAGAAACCAGGCAATTAAAGCCCTTCAGGCACTACGGCGCTGTCGGAACGG
TAGCTTTCCAAGGCATTTCTGCTCAAGCCGCGAATGGCGAAACATTACACAAGTTTTTTGGTGGGGGGATTCATCCCCCAGAAGAAAACATCAATACGGG
CCGCAACATAAAGACAAATTCGCCAAGTTAAAGATGCTGATATCGACGAGGTATCCACAATGGATGTGAAATTTTTGGGCATACCTGATTGTACGCTTCG
TGATGGGAGAAGCCAACCCAACCTCATTTTTGGAGGGATCCATGTTCTACTACTTGGAAATTGGCTTCAACAGCTTCCGGTTGCTGGATGTCCAGCGTAT
TGTGTCATCACTCCTACCCCCCGGCTCCGATAAAGTCAATTGCAGCGGTTCCAAGACGTTCATTGATCGCCTTCGTGGAAACAAAGCGTATCAAACACCG
AACTACGTCGTCATGCTGAACGAAAATATGCGTCACCGCAAGGACTGTGCGGTGACTGGGTATCCACTGTGGAGAGACATGCTAAACCGATGGCGTGTAG
ATAATTACCTCCAGGAAGACTTTGATATCGTTAACGCAAATGTTTTCACGCAAACTGGTCGAATGGTGTCGTGGAGACAAATCAATATTGCCCCATAGTC
GTGACCTCCAACACGTTACGTGCGGAATTCAATGAAGATACTGCAAAAGCATTTTGCAGAAAACACAACCAAGTACTTCACGAATTTCCAGCGACGGTTT
CCCAAGGAAGAAAACCCCTCCAACCAAGTCAACGCAGAAGTCTCAACACTATTCGTGACGACAAAACCGGAAACATGCCAATGCGACTGAGAATCGCAAT
AAGCATGCCTGTTCAGTGCTCAAAAAATGTATCGATGGCACTGAAACTAGCAAATGGCTCGATATGCCATATCGTAGCCATCCAAACCACACAATCTGAC
GCAGCCAAATACCTGGAAGGAGATGGCGTCACTTATCAGATACGTTCAGCACCACCCGAAATAGTTTTCATTCGGTTGAGATACCACAGGGGCGGAAATA
TCATGGCGCAGCTACCAGATGGCGTCGTACCGATACATCCAAGCGTGCGCATTAGCATTCTGGGACGGTCTTTCGTAGTGAAACTTGCCCAAACACCAAT
TGTGCCAGCGTTCGCACGGACCAGCGAAAAATGCCAAGGCTTAACCGTCGAACGGATGATTCTTGCTCCATTACCCCGCCACACGATAAGAGCACCACAA
CGCTCCTCCTTCTATGTTGCTATGACCCGTGTCAAAACTATGGAGCAACTATTTCAACTG