Description :
From Genome Similarity Track
Location :
Scaffold_29:67586- 72931
Sequence
5345 bases(100 bases per row)
GACCCGTTACACCTGGTAGCACTTTGTAGTCCGTCCAATGACCATAAACATGTTGGATGATGAGGGGATGACTTCCATCCCACCCATGTAAGCTACTCCC
ATTTGAGTAAAATCGAATGGTATGTCGTCGAACGTTTGATCTCGACGATAGGGCAAGAAGCCGTTGGCACAATGCTGTCCTCTCGGGGGCCAGACGGACA
CCACACCACCATTGCCACGTTCATCCAGAATGAACTTGATGCTGAACAGGAAAAGGTAACCTTGCTTCACCAACAAGGTTCTCAACAGTTTAAACTATTG
AGACAGCAGCATGCCGCTGCTACCGGGTCGACACACACGTGTCAACCCGAAACATTGAAGATTGACATCTTCATGTACAAGGGAGTAGATGAAGACTCCC
TGTTGATATGGTTTGTGGAGCTGGACGATGTAATAAGGGCTCGTCACATAGTCGATGAGCACATGCAGGTCTCATTTGCTCAATCGAACTTGGAAGGGCG
TGCGAGGACTTGAGCCCCAGGTATCAAGCTGCACGACCCATTTGTCTTTAAGTCGTTAGAAGTCTTCAAATCTCGGCTCAGACAAATGTTTGGACCGCCG
CGAGCTGAGTTCAGCCCTCGCTCTAAACTCCTGAAAATCAAACAAGGCAAACGTGATGTACACTCGTACTTCAGTACATACGTCAGCTTACAAGTTGCAT
TACGTCCAATCCGACGAATGAATAAACGTTGATCACGTTGTTCATGCAGGGTCTCACAGACGGTCCATCAGGACCTATCTCTTCCGGTTTGAATCTGATA
CCCTGGAATAGTCAATCCAAGTTGCGGAACAAGAAGATTTCAGTGTGAAACAAGCTCACGTGAGTTCAAACTCTTATCGTCCGTCGAGACGACAGGAAAA
TGGAGGCCCAGAACCAATGGGCCTCTGTCACGCGGGGAGAGAGAGCTCTCGTGTTAACAACTATAAGAAATTGCAGAGCTGCAATAGATGTCAGACGACA
GGGCATTACGCATGCGAATGCAGTGCCCCGAACGCGGTACCACGTACCGCAGGAAACAGTAACCGCCAAGCGGCCAAGAGAGGTCCAAGGCGTGGGTCCG
ACGTTGTTGCAAAGACGCAATATCGTGACGGATGACCAAAAAACGGTCGGGTTAGTAGGTGCAGATCACCTACTGATCCAGCAACGTCAACTGAATTTGC
AGGCCTCTTGACGAAAGTTGCTCCCAACACTCAATCATTGTGTGTTGCTGCTTCTGGTAATGAGGTTTCCTCATTACCACGAGTCGAAATTGAAAATGAC
ATGTCACTACGAGCCCTAGTCGATTGTGAGGCGTCAAATAACTTTGTACAACACCAATTGCTAGACAACAGCAAGCTCAAATACATCGAGCGAGAGATCC
CTCCAACGAAGATAACCGTACGCCTCGCGACAGGCGCATTCGTACCAGTGATGGAACGTGTAGTGAAAATTACCTATACACTGAGAGATGTGAAATAAAA
TGATGACCCTATCGTATTCGACTTAGACGACAAATTTGATGTCATCCTTGGTGTACCTGGCTCAGAAGGTACGAGCCACAATTCAGCTGGCATCGACGAA
CAGTCGATACGCTTGTCGCTTGTTCACCAGATGGTCGTCTGATGAACGTCATGGAGCGCCCACTAGCATGTGGGTGTACTATGGGTGAGTGTGATGGCTT
CACTTGCGGTACGGTCGTTAGTACGACTGCACAAGATCACAGTGTGACAACAAATCACACTGTGGAGGAAGCTACCGGCGACTGCATTGAGATGCAGGTC
GCGCCGAAGGCCACAACCCGAATAAGTCGAGTGGACTGGACATGGGTGCTTTCCAAATGGTCAACACCCAATCAACATTAAACCGATTGCCAATGATTGG
AAATACGATGATCTTAGATCGATTGGAAAATAGAACGTAGAAGACCTGGCCGCGGTAGCGCAACCACCTCCAGAAGACTTTGAGGGAACAAGTCCACTCG
TACCTGATGATCATATAGTCCAAGAGGCTAGGGAGGGAATAAGTCCTTAACCAACTATGGAAAATAAATTATAAGAAGATGACATAGACATTGAATATCT
TGGTCAATGACGGATCAAGTATAGATACCTAAAAACTTGATCTGATCGCGCCTCCAAAGTCAACTTCGGAGATCACTCAATTGCCCACCCTAGGACAGAA
GAGGTTCTTGCGTGATCTTCGTAGTGGCAAATCCAAGCAGATCTGCGTACTTGTCCCAGAGGACGAGTATGTCACCGATATCCGGTCGGCAATGGTCTTT
GCCGAGAATGAAGGCTTCTCAGCAGCTCATGAATGGTCGAGAGTGTCCTTGATGAGAAGACACTAATTGAGCGATATGCATCTCAGTCGTGGGAATCTCT
CCAAACAAATTCTCTCTCCGATAATTATATTGAGTTCAGGGATGTTTTTCCCAGAAGCAGTGTCGTGCGAGTTACCTAAGGACAAAGGTACTCGTCGCGA
AGTTGACCTGAAACCGGGTTTGAAGTACTGTGTCATGAAGGAATGCCCCGTGAATAAGTACTAGCGGTCGACAAATTCTTTGCCGATCGTTCTGCAGCGG
TTCATGTGAGGGAGTCAACCTCCCCACATAGCTCTCGGAACTTTTGTGTGCGCAAGGCCATTCATTTAGCAAGTTGAATGCTGCAACGGTACCGGCTCAA
ACGCCAATACCAAGGAAAGATGTCATCATAGATGGTATAGCTAAGAGTACCATCTTTTCATCGACGGAACTGATGGACGGGTTCTATCAGATCCTTATGC
GTAAACGGGACATCCCGTGTACATCAGTGAGCACCTCAAGCGGTATGCTATGGGAGTGGCTGGTGATGCCACAAGGATTAAGCAATGCCCCATTAAAAAG
ATGTGTTTTGAATCTTTTCAGACCAGTAAGAGATTTTGCACCCAGCTACTTTGATGATTTGCTCGTCCATAACCAGGCAATGGGTGGAAAGACGGATGTG
TAAGTCCACCTTCGGGAGGTTATGCACGAGCATAAGTTGTATGCCAACCTCAAGAAGTGTATATTTGCTGCTAGCGAAATACCACTTCTTGGGTGCATCT
TGGGTAAACATGGCGTCCGGCTCGATCCAGAAAAGATCAAGGTGATCAAAGACTGGCCGGTGCCTGCAGATGTGAAAGAACTTCGAACGTTCCGTGGTCT
AGCGGCGTACTTGCACAAATACTCGCGCAACCACGCCGAGATGACCGTTCACCTTTCTCGTCTCTTGAAAAAGAACGAGAAATATTCATCGGGACGATGA
TTGTCAGTCTTTCTTTGAAGGTATCAAGCTGAGCTTGATGCCATCGCCCATCTTGGCTATTACAGACCACAACAGACCATTCCATGTGCTCTGTGACGCC
AGCTATTTCGCAATCGGCTGTGCATGAAGGCAGTACGATGCAGAAGGTGCGGAACGTGTCGATTGCTATCAGTTGCGTCAGCTGCAAGCAGCTAAGCGCA
ATTACCCAGTGCTTGACAAGGAACTTCTTGCCATGAAATATGCACTGGCTATATTTCGCGTCTATCACCTAGGAGGTAGACCGTGTGTAGTCTATACGGA
CCTTACGTTATTACGCACGGCCGTAAACAAACCACACCTCTCTTAAAGAATGTCGAGGTGGCTGTCTTCTTTGCGGAGTACAACTTCTCCGTGGAGTAAA
AACCCGGACGACTTAATGTCGTCGTGGACGCGCTATCGCGCCGACCCGACTTCGAGTCGGCTGCGCAGTCCAACAGTTGGGTTGATACCACTGTTGCAAC
ACTAGTCACAAGTGTTTCGTGGTCAACATTGCTTGACGACTTCAAAAAGGCCTACGCAGAAGATAAGGCTATTCTGCGACTAATGGATCATCTAGTGGCT
CCATCTCGTAAACCTCCCAAAGATTTTAGGGCCTTGTATCGATCTTCTGCGGATCGATACACAACATGCAACGGGTTGCTGTACTATACAGCCGTTTCCG
GCGACAATACTGGTTTCGTCGTTCCCACTCACAATGATTTGTGCTTGCACATCTTGTACGAGTGTCATGATGCACCATCTAGTGGGCATCGTGGGCGCGA
GAAGACTTATGTCACGGTAAGTCGCGACTTTTACTGGCCCCGCCAGTATCACATCGTGCGCAAGTACATTCGTGCTTTCGAGGTGTGACAACGGGTGAAA
CCTAGTCCTTCATCCCGTGCACAACTACAGCCTCTCCCAACCCGGAAGAGTGATGGCAGTCCGTTTCAATGGACTTCGTCTTCGGGTTTCCCAAAGACGC
ACAGAAGAATAATGGTATTCTTGTGTTCGTTGATCGCTTCAGCAAGATGGTACATCTTGCTGCTGTTTTAGAGTCGATAATACACAGGGCTGTGACCGTG
TCTTAATTGACACGGTATTCCGACTTCACGGTTTACCCCGTGACTAGTTGCTGACAGAGACCCACGGATCACGGCGGACGAGCTTCAGCTATCCGTGTTT
AGATCACTACGAACAGGTCTGAGTATGGCAACATTTTATCCTCCAGAGATAGATGGTAGACGGAACGCGTCAACCGCGTCCTCGAAGAGATACTTCGAGG
ACATGGTAGAATTTGCAATCAAAATTTATGTGCATGCGTCAACAACGCATACGCCGTTCTTCATGAACGGCGTATGCCATCCACGCATACCCGCCCAACT
AAACTGTGACTCTAGTTTGAAAGGGAAGCTCCAGCAAAAACTGTTCTGGTTCTTGCTCATCACGCGTCAAGGTAATCGACGACGCTAACGATGCCGATGT
CGACTTAATCGACATCGAAGAAGATAACCTCAGCAATAGTGACGACCCTATTGCTGACCCAGACGAAGACAATGATGCTGGTATATTTTGAATCGTCAAT
GTCCACACCAACGAGGATTAGAACACCCTCGTTGAAGAAGAGAATGATCGCTTAGCTGTGCGCACTAGGCGCACTGAAACAAACACAACAGAGTCAGCAG
AGAATTTTCTGTTGACTCGAGAATCAGTCGTCCGATTCGTACAGGACTCCATTCCTGAAGCGGTGGACCGGCAAAAAAGGAACGATGATGAATATAAAAG
AAAAAGTTCTTCTTTTTAATGTTGGAGACTTAGTTCTACTGTCCAAGGAAAATATACGGACAATTTACCTAAACGTGTAGTAACTAAGGAGGGTAATAGT
AAACTGCTACCAAAGTACATTGACCCCTTTCGTGTACCGCATCGCACTGGCAATGCGTACGGGATCGAGTTGCCTCGTAGGATGCGCTCGAATCCTACGT
TCTATGTGGGGCGACTCCGCCTGTACTATCAGTACGCATCTTCTA