Description :
From Genome Similarity Track
Location :
Scaffold_10:675817- 678258
Transcript NameFunction/comments
Aphas_H257_04679predicted protein putative

Sequence
2441 bases(100 bases per row)
CGACGCAAGTACTTGGAACAGCGCGAAGAAAAGCTCAAGAAGCTCGTGGAGTCGTCGATCAAGGACGAGCATTTGCTGTTTGGTGACGAGAACCTCACCG
AGAAGGAGCGCAAGCAGCTCGAATTGAACGAAACCATCTTGGCGATTCAAAAAGCTAAGGCCAAGGGCGACAAAACGTTGGGGTACCAGATCCCGGACGC
GGCCGACCAGTACGACGAGAACGGCGACCGCGTCGTAAAGAAGGATGAACTGTACGACGACGACGACGACGAGGAAGAGGTCAAGACGGAACAGGAGCGA
TGGGAGGAAACGCAGCTCAAGAACGCGACGCGGCAGGGTCTGTACGGCGCCAAGGACCGCGCGCCCGATGAAACGTTCGAGTTTGAGTTTGACGACCAGA
TTGAGTTCATCTCCCAGCGACTCATGGCGGGCGAGAACGTCACCCCGGCCGACATCAAGGACGCGCGCAAGGCCGCGGACGAACACAAGCACCTGGACAT
GCAGGAGAGCCGCAAGCGGCTGCCCATCTACGCGTACCGCGACGTGCTGCTTGAAGCCGTGCGCGATCACCAGGTGATCATCATGGTGGGGGAAACTGGC
AGTGGCAAGACGACCCAAGTGCCCCAGTACCTCCACGAAGTCGGGTATTCGCAGTTGGGCAAGATCGGGTGCACGCAGCCGCGGCGCGTCGCGGCCATGA
GTGTAGCCGCCCGTGTCGCGCAAGAGATGAACTGCAAGCTCGGCAACGAAGTCGGGTACAGCATTCGGTTTGAAGACTGCACCAGCGACAAGACTGTGGT
CAAGTACATGACGGACGGGATGCTTCTCCGTGAGTTTCTTACCGAGCCCGACCTCAAGTCGTACTCTGTCATGATCATCGACGAAGCGCACGAGCGCACG
CTGAGCACAGACATCTTGTTTGGGCTCATCAAGGACATATCGAGGTACAGATCCGACCTCAAAGTGATCATTGCGTCCGCGACGCTGGATGCGGAGAAAT
TTAGCGTGTACTTTGACAACTGCCCGATCGTCAAGATCCCCGGACGTATGTTTCCCGTCGACATTTTGTACACGCGGGCACCCGAGGCCGACTACCTAGA
CGCCGCCATCGTCACGGTACTCCAGCTGCACATCACACAGCCCCTGGGGGACATTCTCGTGTTTCTCACTGGCCAAGAAGAGATTGAAACCGCCGAGGAG
ATGCTGCTGTTCCGCACACGGGGGCTTGGGTCCCGCATCCGGGAGCTGCTGATCCGACCCATCTACTCGACGCTGCCGTCCGAGCGCCAGGCCCAAGTAT
TCGAGACAACTCCCCCCGGGGCCCGCAAGGTTGTGCTCGGCACCAACATTGCCGAAACCTCATTGACCATCCCCGGCATTTGCTACGTGATCGACGCCGG
CTTTTGCAAACAAACCAATTACAACCCCCACACGGGCATGGAGTCGCTGCTCGTGATGCCAATCAGCCAAGCGATGGCCAACCAGCGCGCCGGTCGCGCT
GGCCGCACAGAGCCCGGCAAGTGCTTTCGACTGTACACGGCGTGGTCATATCAGCACGAACTGGACGAGACCACCGTGCCCGAGATCCAGCGCACGAACC
TCACGTCCGTGGTGCTACTGATGAAATCGCTCGGGATCAACGACTTGCTGCACTTTGACTTTATGGACCCACCGCCGGAGAAGTCGCTTATCCGGGCGCT
GGAGCAGCTGTACGCCCTGAGCGCACTGAACGACCGCGGCGAGCTAACCAAACTCGGGCGGCGGATGGCGGAATTCCCCCTCGACCCGATGATGTCCAAG
GCCTTGCTGGCGTCGGAAACGTATGGCGTCGTGGAGCAAGTCCTGACGGTGTGTGCGATGCTGAGTGTGAACAACACCATCTTTTACCGACCCAAGGACA
AGGCCGTGCATGCCGACAACGCTCGGCTCAACTTTGCGCGGGGCGGCGGTGGCGACCACATTTCGCTCATGAACGTGTACAATCAGTGGGCAGAGACACA
GTACTCGACGCAGTGGACGTACGAAAACTTTGTAGTCGCGCGAGCGCTCAAGACAGCGCGCGACGTCCGCGACCAGCTCGCCGCCCTCTGCGACCGCGTC
GAGATTGAAAAGTCGTCCAACGAGCAAAACACGGAAGGCGTGCGCAAGGCGCTGTGTGCCGGGTACTTTTACAACACGGCGAAACTGGATTCGTCGGGTG
CGTACAAGACCATCAAGCAGACGCACACGGTGCACATCCACCCGTCTTCCGTGCTGATTAAGCTCGAAGAGATGCCGCGGTGGGTCGTGTACCACGAGCT
CGCGTTCACGTCGAAAGAATACATGCGCCAAGTGATTCCCATCAAGGGCGAGTGGCTTGTCGAGATTGCGCCCCATTATTACAAAGCTAGGGAAGTCGAA
GACTCCACCAACAAGAAAATGCCCAAGTTGATTGGCAGGGC