Description :
From Genome Similarity Track
Location :
Scaffold_34:67550- 70222
Transcript NameFunction/comments
Hyaar_Emoy2804984hypothetical protein
Hyaar_Emoy2804985transmembrane protein, putative
Hyaar_Emoy2804986Poly(A)-specific ribonuclease PARN-like protein

Sequence
2672 bases(100 bases per row)
ATGTATGCTTAATGACGAGAGTTCTTCTCGTTTTATACTCGCGCATGGTCCTTAAGGCTGTCTCCGTGCAGATGTAGGGTGGGTGTTGTGGCTGTCTCAT
TATGCTAGTACGACTGCGATCCAGTGCTTTTGCTTTTGTGCCTTTCACATTTGCACCTAACTGCTGTCGGAAACGATGGCGGGAGGAGCGAGTTGGAAGT
GTACGCTGAAAGTGAAGACGTTGGGGAATGTTTGCTCTGGCGAGGTGGCACTTTAAGCAGCATCTGCCTATTGCGTCTGTAAAAGGCTCTTGTGGTCTCT
CCTGTCGGAATCATACGAGTCATAACTGTGCAACATCTTTACAAGTGCATGTTTACATATGTGTCATCAAGGCTAGAATGTGCTGATGGTTGCGCGTGTT
TGTGTACTACAGGTGCCAGTGTCTTCCAGCGATTCGAAGGACATGTCAAAGAAAAACGCCAAGGCCGTGGACGCAAAACCTTCTACCACGAAGCAGAGTC
GGAAGGAGGTCGATGACGTTTCTGAGACTGCATCTGTGAACCCGGTTTCACCGGTGGATACGGCGCAAAAGAAGAAGCGCAAGAGAAAACACAAGAAAGC
TGCTGCGAATGGCGAGAACTCTGTAAACAGCGTATAATATCAGCCGGTGGTGAGCCATTTCTTCTCTGAAACGCTGCGATTACTTCGATGTACTTCGTGC
GTGATATGTCTCCAGCTGGGTAGCTGCACAGTGACTACTGTTTAGCCTATTCCTGATCGTTACCCGAGATGGCAATGCAGATCACGAAAACGACGGAGAT
GATCCACGAGATATTGAACATCCTAAATGCGTGCTTGTTGCCTCGGCCAATGCACTTGCTCATCCAGGGACAATGGTGGTCGTGGCCAGCGATGCACACG
CCGCAGTCCTCGCAATGATCCGTTGAGCAGTCCTGTTGAATGCTGCAGATATCGCAAAACCGACGTCGTGTCGGACGTAAGCGACGATCATGTGCATAAC
GGACGACCGACGACTCCATTGCAATTGTCTTGATTGCCACGTGTTCAGCTTCCAGCTCAGTCGCCTCGCTCTCGTCTTGAGTCAGTGACTCGTCTTTCTT
GTGCTGTAGCGGCTGCACAATGCCTGGATCCGTGCACGACGTCTGGAATAGATAGTACAGTGTCGTCCCGCATAATCCCAACGTCATTAGTGTGTTGTAC
CATGGCATCGTAGCCACACACTGGAAGAGGAACATGCCCGTACACAGCAGCACGATACTTAACGTGACCAAGACTCCGATCCAGTGCGGCCCTACAACCA
AGAGCGTCGTCTTCATTCCATCGCCATCGCTTCGTTCATACAGGATCTTCAGCAACACACAAAACCCAGAAAACGCCACGTGAGACTTGCAATGATCGGA
TACTTTCGTCTCGAATCATATGGTACTACTATCACCACCAGAACTACCACTTACGTAGCCATGTCCGAGTCGCTTGAACTTGCAGCAGCAGAGACAGGCA
AGCGGGTCGGAGCTGTTCACTGGCTGCGCGAGAACAGGTAGCAGCGCTTCTTGGTCGTAATCTCCAGGCTGAATCTGCTCCATGTGGTCCTGCGAATTCT
GCACTGTAGCGTCGCAATGTTAATGGACGGTGATGTTATAGTTGCTGGAACACAGCGGAAAGATGGAAAGTGACGTCCGGACTGGTAGAGTCGGTGTACA
CGCAAGCGTATTCACCTCACGAAAGCATCTATTGCTCAATTCTACAGGTCTCCATCGGCGCTTCGCAACAGCATCCACGACTGACGACACTTCTTCTTCT
CTAGCTACGACTCCATACTCTATGAAATGGTGCAGCGGCTCCATGTTGACGCCTCCTCTTCTTCCTCGACAGCAGCTTTCACATCCGCACCATTCAGATT
TGATGACAAGGCGCAGGCAGCCAAAATCTTCTCGAAAAGTTTGCGGTCAGCCTCCGCTTTTTCCACTCTTGCCTTCTTGGCTTCAGCAGCCACGTGCTCA
TCGTACGTGGTGACGGCCACACCAAACTCGGCCTTGACTTCGTCGTCCATATCTTCCACCGGCTCTGTCAGGATCACGAACGCGTCCTGGTCGCTCTCCC
GTACGATGCGTTGCACCTTAGACGACTTGAACACGTCTTCCATGCGCACGTGCTGAATCCGACGTTTCGTGGTGCTGGTGACACGGTATACACGGGCGCG
GTCGATTGTCTGTAGAACGTTGTCCAAATCCAAGTAGCTGCCGTCCGAGATCATCAGGTTCAGCTGGTTCTTGTAGCTGGTCAGTTCTTTAAGGCGCACA
TCAAGGCGAGCAAAACAACCTGCTTTGGGCAGTGACTGGTCAAGCAGCTCACCATCGGCATCGTGAGCCAACAGACCGAGGAAACAGACAGCTGTCATGA
ACGCGTCGAATCCTGCCTCATGGCACAACGCCCTCTCGTTGCCGTCAGTCTCCGTCTTGAGTGCTTCACGGTACGTGTCGAAACGCTTGCCACAAGGAAT
CAAGCTCGCGGGATCCGGCTTGACGTTCTCGCGCATGTACTCAAATAGCGACGAAAGACTGGTAGATTTCAGCTTCTCGCCAAGAGGAGAACGCAGCGCG
ACATGCTTCGTATCGTAAATAGTCGGAAACAGCTCAAGCAACTCCGTCTTGAACTCAGCCAGCGTCTCAGGG