Description :
From Genome Similarity Track
Location :
Scaffold_23:67530- 103676
Transcript NameFunction/comments
Phypa_INRA-310PPTG_10741calcineurin-like phosphoesterase
Phypa_INRA-310PPTG_10742hypothetical protein
Phypa_INRA-310PPTG_10743hypothetical protein
Phypa_INRA-310PPTG_10744molybdenum cofactor synthesis protein
Phypa_INRA-310PPTG_10745hypothetical protein
Phypa_INRA-310PPTG_10746hypothetical protein
Phypa_INRA-310PPTG_10747hypothetical protein
Phypa_INRA-310PPTG_10748hypothetical protein
Phypa_INRA-310PPTG_10749hypothetical protein
Phypa_INRA-310PPTG_10750hypothetical protein
Phypa_INRA-310PPTG_10751F-box protein
Phypa_INRA-310PPTG_10752hypothetical protein
Phypa_INRA-310PPTG_10753hypothetical protein
Phypa_INRA-310PPTG_10754patatin like protein

Sequence
36146 bases(100 bases per row)
AAGAAGTGGTGGGACGACTCTCTCGAGCAGGTGAAGAAGGACCTGGAGGCATCCACGGCTACGTGGAAGATCATCAACTCGCACTATTCTCCTCACTTCC
ACATGAGTGAAGACAAGATGAAGGAGTGGTTTATGATCACGAAGGAATATGGCGCTCACGTCTGGTTCAACGGCCACACGCACGGCTTCAACCACGACAT
CAGTAACTGGGGCACTCACTTCTACGAGAACGGAGGTGGCGGTGGCATCCAGTCCGAGACGTCGGGTCTGCCGCCTGAGGTTGCTGAGAAGTACGTCGAG
CACGCGTGGATTGCTGCTGGTAACCCATACGGTTTCTTCATGCTGCACTTCTCGGAAGACTGGCTGAAGACTGAGTTCGTGACGTTCGATGACTCGTGGA
CTTTCAGTGTGAAGAAGGATGAGATCGTCAAGGGAGGATACCAGAAGGGCCACTGCTGGCACGTGCCGGTGACTATCGGTGCCGGTAAGGAGTGTAAATC
GAGCAACAGCGCAGTGTAAACGGCATTACCTCTCTAAATGAGAGACAACAGCTATCTGTAGGTAGACCTTCTGTAGTAAGCGGCAACTGTCGTTTACTGT
TTGATCGGTAATACATCAAATGAATATCACTCGTAACACTCATGCGACTTTCTTGGTTATCTACAAGTGAAAAATCGCTTGTAACGTTAGTGAAATGGCT
TAAATACTTGTAAGATGCTCTAGGCATCTTCCCCTGGAGCTCGTAATTTGCCAGCGTCATTACGCGGCTCAGGTGTTTTTGTCGTTAGAAGACCATCTTG
AGTCACGCTTGGCTTCAACTGGGTAGTTCCGTTAACAGGCGAAGAGCTGACGCATGATTGCTGTACCGGTACTTGTGTCTGCTGGTGTTGGTCCTTCCCC
AGTCCTATGTCATGATGAGGCGCTGGGTTCGTTGGCTCTAATACACTGGAATGTCCATCAGGTACCTGTTTACCATCGAGCGGTGGATGGAGACTTCCTG
GCCCGGAGAGTTCATATCCATTCCCCTTTGCTGGTTGGTTTTCTACTTTCCCACTGACTTCGCCTTCGGGTTGGACTTGCGTCTGATTGTTCGGTGGGGA
GTGAGTCTGCAGAGTTTGTTCACGGTTCTCTTGCTGTTCTTCCTCTGACTGACTATTCTGAGCTTTCTCCATCTTGAGTGCATCATTTTCTACCTCCAGT
TTGTCTATCTGCTTGTGTAGTTCTTCGACCTGCTTCCGCAAGTCCCCTGCTTTCTGTCGCCATGAATCTTTCTCTACTTCGGCCTTCGCCACGTACTCCT
CTGCTTGAACACGAAGCGATGTCCGCTCTTCCTCGAATTGACGTTTCAGCTGCATCTCCACATTGCCCACGTATTGTCTCGCCTCCTGCATTATAGTCCC
ATGTACGCGTCCGAACTCGGCGATTCTCTTCAGCTGTTCATCTGTATAAGAAAAAAAAACCACCGTCAGGACCTTTAAACCTGGAATAAAACACCGGAAG
CTGTGCAAACTTACTTGTAAAATGATCTTCTACATGAGCAATCACCCTCTGCTGCCATTTTTCAAGCTCTGCTGCGGAGATGGTTATCATTTCTTCTTGC
TCTTGCTCTTCCTCTTCTCTCTCTTCGTCACTGGAATCATCGCATCTACTGACCGCTACATCGTCTCCACTGCTGCGTCGCTTGCGTCGGTGCTTCGGTC
GTCGCACGCGGGCTTCTCGTCCAATAGGGAGCGCTGTGTGCAGGTTCTGGCCCGGAGGGAGGCTGTCAGACGACGACTCTGTGTCCATAACGGTCAGCTT
TTGCTTGATGGACGCCTGACCGCGCAGCGAGGACTGACTGGAGGTAGACAACGTCGATCTATTGGCTTGTGGATGCCGGCTAATGCTCTTGTTGCGGGTC
ACTGGCGACTTCTTCCGGCCCATTAATGCTCTTGGTCGGAAGGTAATGGATTTGAGCAGTTTGAAACAGTTACGATATTCCCAACAATGACTGGCTAAAA
ATCGTTAATGACAGCATGGCATTGGCTAGCGGGTTTATAAGACCCAGTGAGTTGTCAGTTAACGGAGCTGCTGCAAGATACGCGCTGGAGGACAGTGCAG
GACGATTGAAGTGAGACTGTTGAAGTGACTGTAGTGTGGCTCAACATGGTTTGCTTACCTGCGAGGACGGCAGCACCGAAGCCGTTGTCGATGTTGACCA
CGCCGACGCCAGGAGAACAAGCATTAAGCATTGTTAGCAGCGGTGCCAAGCCACCGAACGCTGCACCGTAGCCGACGCTGGTAGGAACCGCAATCACTGG
AGCTGACGTGAGGCCACCCTGTTGTGAGCATTGGGCAGTATGTTGGTCAGAACGCAAGGTACTAGAGATCTTGAGCATCTTTAGTACAGTGGAGGACGAC
GCACCACAACACCGGGTAGAGCGCCATCCATTCCAGCAACGCAAATGGCAACGTCTGATGCTCGCAAAATGTGCTGGTTGCGCAACAAGCGATGGATTCC
AGCTACGCCCACGTCGTACAATCTGGTGACACGGTAGTCCGCCAACTCTATCGATTACAAAGAATACGGTTAGTTTGCCAATGGTGAATATCCATACAAT
GCTATCGAGTTCTCACCAAGTGTAACAGCGGCTTCTTCTGCAACGGGGAGATCCGAAGTGCCGGCACATAGCACACACGCAGTGGGGCAATCCTACAACA
CATTGCCCAATATATGGCACTAGGTGAAACACAACTTGAGCAACACAGTACCAAGACAGCCCAATACCATTTCTACATCTCCCTTCGTTGCACTCTCCAG
TGTTTTCGATGCCAAGATCCGTGGCATCTCGTAGTATGTCAGGTGCTGGCCCTGTTGAACACAATCAAAAACAGCCATGACTCCACTGTCGCTTAAATTC
GCGCGGGTAGCGCTTGCGTACCGGCATCAGTGCGCGGATCTGATCAGCAGCTTGTGGGGTAACGCGTGAAGCCATCACGTTGTCCTCTCCTCCGTCAATC
ATGGCTTTCATGATAGCCGCCACCTGTTGCGATGTTTTGCTCTCAGCGTACACCACTTCGGGGAACCCCGTACGCGCCTCCCGTTTCGTGTCGATCTTAG
CAAAATCCCCCACTGCCTCGTACTCTGCTGCTGGACCGCAGAGTTCCGCCGCTTCTTGAGGTGAGACTTTTCCATCTGCCACACGCTGAAGCAGTTCCAA
GATCGGCTTTTTGTCCTCCAAATGCGAATTCGATGAAGTAGACAGCGTTGCAACGCGAAATGTAGGAACAACGCGTTCTCCGCTAATAGTAGAGGCAGCA
ACATGCAGCAACACGTGACGACGCGAGCGCAGAACACCAACGAGCGCCATGATCCAAGGTCCCGCAAGAAAATGACACGCCACGTCAGTCAATCCAAAAT
TATTGCAAAATTTGCACTACGATCTCTATTGTCAAAATTGCGCTCCAGATTTACCGACAGTGACAAAGTTCCACAATGTCTGCTCCTGCGTGCTCCCGTT
GCACGGAATTGGAGCGTGAACTGGCGAAGCTTCGTGCGCAAAATGCCCAGCTTCAATCTCAGCTTACAATGCACCGGAAACCTAAAGAAGTGGCTACAGA
AGACTACGAGGACGACAATGAGGAAAATTCATCGAAGACTCAGACGTACTCGCCCTTCTCGAGGGTGGAGCTGCAGCGTTATGGACGGCAGATGCTCGTT
AAGGAATTTGGAGTCAAGGCGCAGCTCACGCTACGTGCTGCAAGTGTCCTACTCATTGGCGTTGGTGGACTTGGGTCGCCTGTGGCGATGTACTTGGCAG
CAATGGGCGTGGGTACGTTGGCTATTGTGGATAGTGATTACGTCGATCGAAGCAACTTGCATCGGCAGATTTTGCACGATGAAAAGGGGGCCAGAAATCG
AGAAAAGAAAGTGGAATCGGCTAAGAGAAGGCTGCTGGAGCTTAACCCGTTGCTGAAGTGTGTGGTATATCCAACAAGGTTTACCGCTGTGAACGCGTTG
AAACTTGTTGGAGACTACGACGTGGTTGTTGACGCCTCAGATAATGTTGGCACTCGCTATCTCGTTAATGACGCGTGTGCCCAACTTCATAAACCGTTGG
TATCGGGTAGTGCTTTAGGACTGGAGGGCCAGGTGACGGTGTTCACGTATGAGGATGACTCGAACGCCACTGGATGTTATCGATGTTTGTATCCAACGCC
GCCTCGGGTTGCAATGAGTTGCGCGGAGAACGGTGTGATTGGTGTTGTGCCTGGCGTGATTGGATGTCTGCAAGCTATGGAGACGGTCAAGATTATCACC
GGAATCGGAGAACCTTTTGTTGGTGTACAGTGCTTTTACGATGCGTACGACGGGCAGTTCCGGCGCCTGAAAATCGGCAAAAAGCGGAATCCAGACTGTC
CGTCATGCGGAGTGCATGATACATATGAAAAGCACAAAATGATGCCATTACATGCATCATTATTAGTAGAAGGCAATTGCACGGATGAAACTACGATCGT
TGATGATCTCAGCCCACAGTTCCGTGTTAGCACTGAAGAATTTGCGAACATACGCAAGGCTGCTTTAATGGCAAAGGAGAGAGAAGAGCAAAACACTATG
AAAAACAGCTATGCTCTGCTGGACACACGTGCGCCCACCCAGTTCGAGATGGTGCACTTCCCCGAGGCAGTGAACATTCCTACCGCTCAGCTCATGAAAC
AGGATCCAACTCAAGTTATCAAGAACCTTCATAGCTTTCAAACGAATAGTTCGGCGCAGCTTCCTAAACGAACTTTTGTGATCTGTCGACGCGGTATTGA
CTCGGTCAAGGTGACGCGATGGTTGGTGGATCATGGAGTTCAGACCGTGTTCAACGTCAACGGAGGATACACTGAATACGCAAAGGAAGGCGGAGTTGAC
CCAGCATTCCCCATGTATTAGCACACATGTAGCAAATCAAAGCGCAAAGCAAACCCTGAATTTTTGAAGAATCTATGATTGCTGCATCTAAACTCTTGCT
ACGTGAGATTCTGGACACCCCAGAGCGGTGAACACTCTAGGATAGCAGACCTTCGTGCATGGAGGACTGCAAAACTGCGGCGTGCGATGCAGTCACGGTG
GTCGGCGATGATTGATCCGACACGCTTTCAGCAGACTCTTCTTTACCTTCACCCTCATTCTCTTCTCCATCATCCTCATTCTCCTCTTCTTCGTCAGGTT
CCTCTTCACTCTCTTCCTTAACCTCAAACGTCTCGTCTTCTTCACTGTCTTCGTCCTTGCCCGCGAACATTAGCTCGTTAAGCTGGCGATAGTCCACCTC
GTTGCGTTTGCGTTTGCCGCGGACAATGAGTGCCTCCGAGTCACCTCCGTCCTCGTCGTCACTGTCCGCGACAGCAGCACGATTGATGGCAGCCTGAGTC
TTACTGCGCGTCAGAAGTTCCGAGCTGCCGTCACGGTAGTCAATGCGCCAGCGTGAATATCTCCCTTGAGACGGTGGTTCCAGCTTTGCAACGACCCCAA
GAATCACTTCGCCAGTCTTAGGGTCAATCTTGGCAGCAGGCTCACCGATGAGGCTTACCTTGTTATCAACGGGCTTTGGTGGTAAAATCGCACTCTTAGA
ACGCGACGATCGACTGTTCAAGTGCAATAACAGAGTCAATATCGAGTCAGACACACGCCAGCGATAGCATAGCACTAAAACGTACTGATTCACATCGATA
ACGTCGTCTTTGCTGAGATACAGCAGGTCTTGAGCGCTCTCGGGAACCTCTTCGGCCATTTCTTCTTCACCGCCTGCTTCTGTTTTCTTCTCGTTCTCGT
CATCTTCTTCTTCATCTTCGTCGCTCTCTTCATCATGTAAAACGAAGTCCTCATCATTCTCTTCTTCATCATCTTCATCAGGAGGAGCCGTAGCAGTAGC
ACTCTCCTCTTCTGACTGAGCAGAGCTACTAGCATCCGCTGTGGCTTGCTTAGCCTGAGTGAGCTCTGGGAACAAGTCTTCGACGTTCTCGTACGTCGTC
CCAAACACCGAGTTAATCGATTTGAGGCACTCAAAGACTGCTAGACACACTTCACAGAACCAAGGCTCGTCGCCTGCTGGGATCTTGGCTGTCAGAACAA
TTGGCGTCTGACATTTTTGATGGTAGGCGCGATGGCAGCCGACACTGTCGCAGAGCAGAATGTCGTTGTCTTGCTCGATGTCGGTGCTCCCACAGCGAGA
ACAGTGAACATCCTCGAACACAGCCATCGGTGGCACTTGCGGCTCGTTGGCGTATAAAGCCTTTAACTCATGCAGACCGTCGATAAGCGCACGTTGTCCT
CTCTCGATCTTGCGGCGCTCTGCGTCGAGCTCCTTGCTGGGCTTAAGTTTGTCCAGACTCGACTTGTTCCAGCCTTCAGCTTCGTAGGCATCAATGAATG
CTAGTGGATAGCGCAGTCGGTGCGCCTGAATATGGATACACATCAGTAAGCGTCGTTGACTACAAACGTCTGTGTAAAATGTATCTATCTCATGTCCCTG
TAACTTACCTGCGACTTGATCTTGTTCTCTAGTCGCTTGTGTTCCGGACGAGCAGGAGTAGGAGCTGAAGCAGAGTTGTCGTCTGTCTCCAAACTTTGTT
CCTTGGGCTTCCGAGGTTTCCGCGTTGGCGTATCGACAGTTGGTGAGAATGCCGCTGGAGCACGACGATCACGCTGCTCCCGTGGCTTCACCTTACTGCA
GTGCATCGGGTAGCGACAGCAACAGTTAGGAGTCATTATTACTGCTACCAAAATGAGGTGATAGTTGTCTCTCGGTTTTAGAGAGAAAGAAATTAAAGTA
TCTAGGATACTTCGTACATTGATGGGCGTCGAGCTGAAGCCGGTGGCGCATATTCGTCGTCGCTCTCCGATGACGAGCGAGCTTTCTTGCGAGGTCGAGG
CATGGTTCTCAAGTTTAATCAGTAAATGGTATGTACTTGGGGTTTGTGGTGTAGACTGGCTGGCTATCTGTCTTGTCTAACAATATAACAAATTTAGTAA
ATCTTGATGGACTAAGAAGAGTGATCACTGTTTTTCTTGTAGTGTCGACAATCTTACCTACAGGTACCAGGTAGGATCAAGTACCGTAGTTTCTGGGTTG
GTTCGTAGGGGGGGAGGACGTCACTACTGACGTCGCTCGAACCAGTTGATGTCGTCGACCACCCGTGTAGTCGATCGATCCAGGAAAGTCAAAAAGTTGG
TAGAATCAATACTCTAAGGCCACTGATGTGTACCAAACGTAGTAGTGATCAAGTCTTGCCGGTGTGTTGGCTCGTTGTCCGGTTGCGTGTTGAGGTGGAG
ACTGACTCAGTGGTTCTACACAATGGAAGCCCCTGCTTGTTCGTCTCTAAAACTAAAAGTTTGCTGATTCAGTGTGCCAAATTGTGTCTCTTCTTTATTG
GTAAAAATTGTGTTTAAAACGATTTTACAATTGGTTGAAATTTCGTAATCGATTGTGCCTTCAAAGGTTGCAGACTGTACCATTGCTGACTCTTGAGCTC
CTCGCTTCGATGGAGTCGCTGACTGACGAGCAGCGCGCGCTGTTCTCCGATGGGGGTCAGTTAGATGACTATGAGGTACTAAAACCCATTGGAAAAGGAA
AATTCTCAGTAGTGTATAAGGCCAAGCGACGACATGATAATCAGGCAGTGGCACTCAAGAAGATCGCCATTTTCGACATGATGAACCTCAAAGCTCGCGA
AAAAACACTGAAAGAGGTGCGTATTGCAATACTGCAAAGTGTATTTATTACGAGTAAATGTTGATAACTTGTCGATGTTGTTCTGCTGTGGTTACGGTTT
TGTAGGTGCGTCTGGTGCAGTCGGTTGGTCACCCAAACATCATTCAATATCTGGATGCATTCGTCCAGAATAACGAGCTTTACATTGCATTTGAGTGGGC
AGAAGCGGGTGATCTCAAGCGTCAAATTCGAAAGGCCAATGAGAAAGGGGTGCGCTTTGATGAACGCACGATATGGAGATACTTCACGCAGCTCTGCGGT
GCGATTCTGTATCTACACCAGAACCGAATTATGCACCGTGATCTCAAACCGGCGAATATTTTCTTAACTCTCAAAGGGGTAGTCAAAGTAGGTGATCTTG
GATTGGGTCGATATTTAAGCGAAAATACGATAGAGGCTCGGTCGAAAGTGGGGACGCCGCTGTATATGTCGCCGGAGGTGCTGCGTGGCGAAAGTTACGA
CTGGAAAAGCGACGTGTGGTCTATGGGGTGTATTTTGTACGAACTTGCGATGCTTCGATCGCCTTTTAAGTCGGAAGGGTTGAATCTTGTGGGGCTGTTC
CAGAAGATTAACAAAGGTTACTATGAAGAGATCCCGGAGGTCTATAGTGATCATCTACGCGGAATTGTAAAACGCATGATCTCCCTCACGCCATCCGACC
GACCGAGCGTGCAGGAAGTATGGGAATTTTGTAGAACGAGACCGCCCAGTGCTGTATTGCAGGAACGAATGCAAAAACATCAGGCTGCCTCTCAAAGCAA
CAATAGCGCTAGACCAGACTCAGAGACGCGTTCTACTCGAACACGAAGTAGCAGAAGTAAATCCACGCCTGAAAGTGATAATCCTTCGCATCCCTCCTCC
TCTGACCAACAGCAAGAAACTCCACCACAGTCACGACCTTCGTCACAGGGAGATGCCAGTAATACAGTATCAGAGGAATCAAGTAGAAGGAGGCGTGCTG
AGGCAAAGATGGAGCTTCTTTTCGAAAGATTGAGAATCTTAAGGTACGAAAAAGTCCTCAACAAGCGAATATNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGAACGTATTAAG
CGAGTATCTGTATTTGCACGGGTTGGATCGTGATCGTCTACGCATTCTCGTAGATGCATCAGCTAGTGATGCTCTTCCAGTGCTTTCAGACAGGAAACTG
GAACAGCAAGGCAAGACCAAAGTTCTAGTTCCATTGTAAGTATTGTAGGTAATAATTGGGGCATTGGGTGATTGACTTAGTGGTTCGGTTGGCTTTCAGA
GGTGGTGGCAAGGATTCACTCGTGGTGTATCAACTGCTATCGTCGAGTGAAACGCCCTGTGCGTGGCTGCATGTTGGAGACCGCCCACGGGAGTTTGAAC
GCAGCTGGAGATTCAAGAGGATCATGAAGATGACGCAGAACCGTACCGGTGCTTCAGCATTCCGCTTCGAACACAACATGGATGACAAGATATGGGAAAG
TGAAGTTGCGGGTACGCGATACCAGCCGGCAGGTCACCCGTGGGCTGCTCTGGTGGCTTTTGACAGCGTACTAGCAGCCATTTTGGGTGATTTTACCCAT
ATTGCAGTGGGCAATGAACGTAGCGCCAATTACGGCAACAACGTTGTCCACGAGGGTCGAGCAGTCAACCACCAGTACGACAAGAGCTTTGACTTTGAGA
CACGAGTACACACCTATATCCGCAAGTATTTGGTGGAAGATTTACACTACTTTTCGGCTCTGCAACACCTGTGGGAGGTCCAAATCGCACGGACATTTGC
GAGTCGATCTCTCGGGAGCTCTGAGAATTTCCTCCCCGTCTTTTTGAGCTGCAACGAAGCTCCTGATGGCGACAAGTGGTGCTGCAAGTGTGCAAAGTGC
GCCTTTGTGTTTATTCTCATGAGCGCGTGGTGCTCGGAAGCTCAGCTGGTGGAGATTTTTGGCGAAAATCTGTTCGAGAAACAGTCGATGTTTCCCGAAT
TTCTCTCGCTGCTAGATGAGGAAGGCGTTAAGCCGATGGAATGCGTTGGCACGGCTTGTGAAACATGGCTGTCGCTGTATTTGGCATTGCGAGCACACGG
AGACAGCATGTTTTTAAAGTCTCACGACCAGGAAATTCGTCTAAAGGGGGAAAAGCTCAAGTATCTTTTGGACGACTACAACAGTGAACACCTACTTCCA
GAATTCCTGGAACCTACTCTGCGCCAACCCGTCATGATGCTGGGAGCTTAGCTTCGAACGTGTAGTGGATCCAAAGATATTCGTTTTGAAAGAAATCTAT
CTTAACATTTGTGTTAGCAGCAATACTTGCTCGAAAGAGAAGAAAAAAAATGTACAAAACTACTGAGCCACCGTCTCCAAGTACTCGGCCACCTCGTCGT
CACCAAGCGCCTGCGCCATCGACAGAGCCGTCTCGCCGTCGATATCCTTAATATTGGGGTCCACGCCCTTGGTCACAAGCAGTTTGACGATCTCAACGCC
TGAGCAGCCAAAGAGGCACGTCTGGCCACTTTCGTTCAGCGCATTCAAGTCGATTTTGTCGCTTGTAGCCAGAAGCTCCACCACCTCCTGCATCTCGAAC
ATCACAGCCACGTGCAAAGCACGATCGCCTGTTGAGGGAAGTGCGAAGTTGACGTCCACATCAAGATCGAGCATCTCCTTGATGACACTCAAGAGGCCGA
AGCGACAGGCCTGGAACAGTGCGCAGTCATCGTCCTCCGCGTCATCGTCGTCATCACCAGTTTCTGCGCCTACTGAAGGCGTCGTGACGAGCTTAGTAGC
CGACTCGATCGCACCGTTCTTAAGCAATAGCAAGGCCACAGCAGTGTGTTCCGACTCGACAGCCAAGTAGAGCGGGTTGGAAGCGTCTTTGGCTGTGCCG
CCGTAGTTCACGTCAGCCTTGCGAGCCACCAGCTCCTCTGTCAGCTCGCACAGTCCTGAGTTAGCTGCCTGCATTAACAGTGTCCAGCCGTGGCGGTCCA
CCACGGTGTCCGGGTTCTTAATGCTCAGACGCTGCAGCAGCGCAGTCGCCACTTTGCCGAAGCCCTTCATAAGCCGCTCAGCCTCAGCCTCCATCTCGGC
CAGGTCTTTCTCAGTCTCCGTGGGTTCTTGTCCATCTTCAGTCTCCTCTTGCACGCCCAGGACGTGCACAAAGGCCTCGTACTCCTGTTGCCAAGTGTGC
AGCCAATCCATGAGAAACACGAGCGGCGACTTGTCCCCGATATCACCCGCATTTGCCAGAAACTGTTCCACATCACCCGATATCACGCTCTGACGCACAG
CATCAAGCTTCTCGTCCACCTGGACGCCTTCGTCTCCAAGCGACAACGTCGACACCGACAGTTCGTCTCCCCCAGCCATATTAAAGTGATAAGACACGCA
CGTAATAATTTGAATGGCTCAAATGGCTTCGCTTTCGGTGAATCTGATTGGCTGTGCCAACAAGGGACGTATAAACTGCGCGACAGGATAGATCGGGTGA
CCGATATAATCTGTCGCAGTGCCAAAAGCGATGCTCTGTATGCTAGCCACCTGATAGACTGTTAAATCCAGACAAGCACCGTCTTACTCTGAATTAGCTA
TAAAACATATCTAAATGGCAAGCTCCAACTCCTAAAATTGACGAAGTTATGGCCGATCTATCCTGTCGCGTAGTGTATACCGTACCAGTATTGCACGAAA
TCTCTGCAACCACGAATTGATGCAACCCGAACGTAAAAAGTCAAAACACGACGAAAAGGTTTGAAGTGACACACCCTCCACAACAGACACCCATCCGTGT
TTAAAATAATAATTAGATCTTAAACAAAAGATGTAAAAGTAAAAACATATTCAGACCCATGATCTAACGCTGATTCGGCTACATCAGAAGGTTCCTAAAA
GTGCCATCGGGCTCACGTGGACCCGCGGGTAAAAGACCGGCCTTAAAAAAAAACGATCAATGCGCTCGTCCTCAATGCTCTAACACGCAAGTATCACGAT
CTGTGTGATAAAAAAAACACGCGCAGTAGTATAATCGGGAAACTCATGGTCAATGTGGTAGTTTACGTGTAGCCTTCGACACCTTGACTTAATCATTCGC
ATCACAGCCACATCCATCTGTTGGGCAAGGCCTGTAATACATGGGGGGACGAACTCAACTTCGGTACAATATTCTTCTTCTAGCTTAGCACGCACACTAG
CCATTTTATGCGTTTTCAGACTGTCAAGCAATAAAAGCCTCTGATTGCACGCATCAGAACACCATACCTGCAGAAAATATTTATTTAAGAAAACATCAAA
AGAGAAAGCTTAAATAAAACTTACCTCATCGATCCATTCTAGCATCACGCATTCGTCACAGTACGCCTTCCGTTGCACCGTGAGTATAACACGATCTTGA
TGCAAAGGGTGGTTTGTAAGCTCATCACGCACGTCGGCGTTAGGAATGCCGGCAAAAACAATAAGCGGCAGCATTTTTTTTACCTGTCGTTGACGCGCAG
AAAAATACTGACGCACGGAATGCATTTTCGGACATCGACTGCACGACGTCTACATTCCTGTCGCCAGTAAAAGCGATCGTTGTGTTTGGGTTCATATCAA
TGTAGATTGAAGTTTGATCCATATTGTACACATGCTCGTACTTGCTGAGTCCCGGAAAGCATGATTTTAATACTGCTATTTTCAGTCGACCAGTGCATGC
TTGCTCCAAAAGCAGTAGCAACAGTCTACATCGAAATGTACAAATTAATACCCAAAAGATATTACAAGAAATAATAATAGAAAAAGTGTACCTCTAAATC
TGAGCGATGCTTAGTACCTCGGTGAGTGATGCGACGTACGGAGAACCTGTTTCGGAGTCTAAAACGCCGCAAATACTCCACTGCTGCACGCTCTGTTCTC
TCATAGAGCAATCGTGGCTCGAAGCGCCCGCCTACAATCAGGAGACACTCACTAGTGACACATCATGACCTATTGCGCCTCATATCAGTCACCCACTCTA
GAAGCCTGCTCCTAGTTGGTTAGAATGACAAATTTAAAAAAAAGAAAAAAAGTGAATGTTCATACCTTTTCTCAGTTCTGGATACTTAATAGACGGACCT
CGGTGCGTATCAACCGCAAACTTCTTCGTAGGGCGAGCAGCCTTGATCTTTACTTGAGGTTTCACCCATCGATACAGCGTCGTGCGGTGAATGTTGTACT
TCTTGGCGAGCTCTGTAGATATGCCGTGCACGTTAGCCTCGTCAATGGCTTTAGATTTCTGGCTGTTTAAATGAGGCACAGACCGCATTGTTAGAATACG
CATGCTTTTATTTGTGAATGGATGGTTGGCTCTGGAGTTGGGCATGGGTTCAAACTTTTTACAGATTTTTGATTTTTTACTAATCACTTAATCAGTACTT
TTTACAGGGTTGCAGAGATCTCGTGTAATACGGTACATGTGAGACTGCGTCAAACAAAATGTAATTAATGCGGCTTTGAGAATTATCGAGATAATCGCGT
TTAAAGTTGGTTGTTCCAATTTCGTACATAAGTGAGTTTGCAAGAAAAACGACCTTTTCGCTTTTCAAAAATTTAAACAGGGTGTACCGATAGCGTTCAA
GATCTCAATCTCCAACACGCCAGACCATTAGAAGAGGACATAAGCAATTTTTTGTTCGAGGGGGGGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAAAAAACCATTAAAAATTTAAATTATTTTCGTTTGAATGCCATCCAGTAAACATCTTTTGTTCACCG
GCCAATCAGATCTCTCGAAGTCACCATCTATGTCCTCCTCTGGAATAATAATCTGATAATAATTCTTAACTGGGGGTGAAGGTTATTAATAATAAAAATA
ATTTTGATTAGAATTATTTATTAATTTCTGAGGATTAGTTTTAGAATATTACCTCTGTGATACACCGTGTACTACACGTACTAACATGTAAAAAAAATAA
TATATTATAGCCATCATGCTAGACTCCATAAGTATTCTGTAATACTGTGATGGGTGTTACTACGAATCCCAGACTGTTATAGCCCTCTTCACTGTAAGCG
TCTAGACTTCTAGCTCAAGTCGCTGCCACGGCGGCTCCATGAGTGCGGCCACCACGGTCATCGATGCACCCTCCACGCAAGTATCTTTATCTCCCACACG
CGCTGCACTGGCCAGCGCATCTGAGAAGGCGGCGGCTATCCCGGGCCAGGTGATTGTCGGCGCACTGCGCATCCGAGGTACGCACCAATTTGTCTAAAAT
AACCGTATTCTGATAGCTAACACCACGCATCTCGAACAGTACTGCAGGCGATCGATTTACCAACCCCAAGAGCTGTCGAAAATGGCTCCGTGACGACTTC
ATCATGGCTACCTTTTGCTGGACGCAGACCCCCACAGCATCAGAACCTGCAGCATGAGGCAATCCCAGACATGATCTGTGTGCTATTACGAGCCTCAAAT
TCGGGAATTTTTGCAACGGAATCACGCGCTTGGGCCAGTGCGATCTGCTGGGATGAAGTGAGTTTTGTGAATATTTCAGAGGCGTTGGATTGATCCTAAA
AACACGTGTGATATTGTGTAGGAGTTTTACATGGAACAAGTGAGTTCGAACGACGAGGTGGAGCTATTCTGTCTGGATCGAGTTAGGAATAAAACGCACG
CAAGTTTACCGCTTCAAGGCGATATCAGTTCATGTCCAGGATACATTGGCAAAGGTGAGGAGGTTTACATGTATTTTTGTAATTTTTACTAACGGGTATA
TTGCTGTGATGTTGGTGAATTGCTGGCAGTGACTTTGCCCCTTACCAGGCTTCCAGAAGGACAGGAAGTGGAGCAGTGGTATCCTCTTGTTCGGAAAGAG
TCTTCGTCTGCGCTACGCACTGCCCTTCGAGTTTCGCTGTATTTTGTTCCGAATGGGGTACCAGCCTCAGTTTCGCAGACTCCTGAAAGAGGGCGCGTCA
CCCCCACGTCAATGCTGCCACCCTCTCCAGCGACGGAGATTTCTTCCGCATCACCCGTGTCGAACCAATTGCGAGTAGAGACCTCTGAAGCTGCAAATGC
TGCAACTATTCCACTCGAATCGGGTATTATTGACTACGTAATTGTGGTAGGGGCTGCAGTTAACGGTGACAACTCCTCAAGCTTGGATGAAGCGCAAGTT
CGTTTTCGATACCCAATCACAGATCGACCGGATTTCCCACTGCCGACAAAAGTTGAGTGGTTTTGCTTCCCGGGTGGACCTGAAATCGTCACTCAAGCTG
ATCGACCTCAGAGTAAAATATTTTCGTTTGTACTGGTGGGTGGCGATGATGGTCTGTGCAGGTGTTACGTCGTGTGTCTTGTGGTGTATCATCGCCGTCC
CAAAAGTAGAGGGGCCGAAGTGAACGAGTGGGATGCTACATGTATAGCGTTTTTGACACGGATTCCGCAGATTGAAGAGGTTACAACATGTTTACTTGCT
GTTGCTCATGCTTGGATTGCAGCAAATGGAGACAAGGAAAATAATGTTCTGGAAAATACTGACGAATTGCGGCTGACAAATACACGAAAACAATTATGTA
GTCTTTGTCACGAGATCACACTACCAGTTCGTGGTGTTTTTGGCGTCCAGTTTGCTGTTCACAACGTAAAAATTCGAATTATGGTGCCGTCGATGACATC
CATTTACACGATGAAAGAGGCTGTACTTGCACGACCAGAGCTTCGACGTACAGCATCAGCTCAGGGTGCACAGCCATCTCCTACGAAAGCGAGAAGCTTC
ATCGCTATCCAACAAGGTTTCCAGCCTCTGGTGTATTCTCTCGAGCCAATTTTCCAGCTCTTCGATATCAAGACGATCATCTATCTCGTGGCGCTCGTTC
TCTGCGAATACCGGATACTTATCCACTCTACACAGCAGTCTTTGTTGTGTCCAGTAGCTGAGGGACTTTGTGCACTCATTTATCCGTTCCGATGGCAACA
CCCTTACGTGCCTATTTTACCTCGAGTGCTTTCAGAATATCTCCAGGCCCCTCTCCCGTACATCCTAGGAATTCATACCAATTGGCTACAAAGTTTGCTT
GAAAATGGTCGTCCAGAGCATCTCGTGGTGGTTGACATTGATCGCGGGACCATCCAGTTGCAGGAATCCGGCGGGCCAGTATTACCTCACAAATTAACAA
CAGCTCTTCATCACAGGCTAAAAACTATTTTACATCCGTCATTATTTGGAGAAATGGAGAGCAACACTGATGACGAACCGAAGCAAGACGTTAACAAAGA
GCGACGCGATATCGTTGAGTGGGGTCCTGACACAGGAAAGCAAGTGCGGATGGAGTTTGTGTGCTTTCTTTCTACGCTCGTGAGGGGATACCGTGAGTGC
CTGTTTTTCGTGAACCAGAAGCTTCCAGTTTTTAACAAGCGTCGCTTTTTCGAGAGTGAAGCTATCGACAGTGAAGTGACTCCGTTGGTGACTCGGCTGT
TCTGCACGCAGGCCTTTCAGGCGTTTCTCGAAAGCCACAGCTCAGCTGAGCTAAGTGTGTTCCACTCCGTGTATCTCACGCTTTGTCGAGGACCAAAGGA
TTATCAGTGGTCTCAGTCCACTCGAGCCTTATTAACATCTAAGAGCCAGCATTCGTTCCTGGATACAGGACCAGCAAAGACGGATATACCGGTTCTTGTC
ATAGAAGACCCCAGAACTAGCAAGGGATCTAACGGTGACAATCGTGATGGAGGTGTACCAGTACAGGTTACTCCGACGACCTTTTCAACGTTCAGTGATG
GAGAAGTCGATATAGATACACAGGAGACGTTGAAAGATTTGGGCATAAAGATCGAAAACTTGCTGAATGAGGAGAGAGCAGTTCAATGGGACCCATTTGC
GCTTGAGACCAGTGATATCGATGCTCATACGGCTGCTTCGTCTAAGTCGAGTGAGAACTTGAACCATGAGATTCTCGCCCGAAAGCTTGGAGTGGAGCCA
AGATTGCTGAAAGCAAACGCACATTTACTGAAAAACGCGCACCAAGTGAACCAATATCGCCTCCATATTGACAGCATGGCTGCGGCTGCACTAGCCGGGT
CACCTGGCCCTGGCGGGCGTTTTCTATCGTCGGAAGATGAACGAATCGAACAAGTGCTTCATAAGTGTTTGACTGCAGTGTTCACGTCTGATGACTCGGT
TACCGAGCAAGAGATACGGGTATTTTATGCTTTACCAGTTATTTTCTTTTTCTTTTTACTGACACGGAGTTCTACGTTTTGTTATGATTTCCAGGCTTGT
GTGTCATATTTTAAAAGCGCACACGCGAGGGATTTATTTGTTCTTATCCTGATGCAACCTAGCAATCAGTACGTTGAAAGCGTGAATGGATCTCCTAAAG
CGGGCGGTACGATGAGCTCTTCAGCATGGTATAATCCGAAGGGTTCTGGGAGCTACATTGGCGCAGCAGGGTTCCGGTTGCTCGCAAGGTTGACGTCAGC
ATTAATGAACCAATGTGCGGTCCATGAGGATTACTCGACGGCGCGTGGAATCCTTCAAGTCGCACCCCAGTACTATCACTATGTGGAGGATAAGCACAGT
GGTATCGGATTCGGTAAGGCTCTTCATGCAATGATGGGCGTGTATAATCTCAATACTTATTGATGTTACGTTTTATTACAGCAAAGAAGGAGTACCTTGT
GACACCTCTTCGCTTGCTGCCCATTTGTCGATCGCTGGATTTATGGCAGCACGCGTTTATCTGCGAGATCGATGCTGCGAACCAAGCAGATCCTACCGAA
TTTGACGAAGAAGGCCCAAAGACTGTGGGAGACGAGCTCTTCTTTTCTGTGATTGGGAGTCTGATGTACGACATGCTCAACTATGAAGTACCGCTCCAGA
AAGTGTTGACTTTCGTGACAGTTATGTGCTCGACGTACCAAAAGGAGAAAGAGTTGTTGGACACTCTCAAGCAACTCGCAGAAAATGTGTACCGTGCTCT
CGATATGTCCAAGGACATCAAGCCCTCTCCACCTAAAGATGCTGTTCAACCCAGGATCAATGTAAAGACCGTAAACAACAAACCGCCACCTGCCGCTCCT
TCCAAGCTAGAGCTTCCTCCCGAGACTTCATCGTCTACAGCACCGGTGGTATTTGCTGAGAGTCCGGTGTTATCACGCGAATATGATCTGAACACGGTAA
TTCGCCGCAAGATGTCGGTCCGGGAGATGCCTCAACTCAGTCAGGTGAAGGCGGGGAGTCTGGGTGATGAGCGTATTACCAATGGCAATCAACATCCCGC
AGATTGGATGAGTAGGACCCCACCTACACGTCGAAGGAGAAGTAGCGCTGTCTTCCCAAGTGCAGTGTTGGCAAAGTCCGGTTCACCTGTACTTTGTTTG
GCTACCAATAACGACCGTGCAGCTTGTGGTATGGCTGATGCGCGTGTGAACGTCGTAGATATTGATCCATCTGAAGAGGAGAAAGGTATCAGACTTGACG
GTCACAATGATGCTGTGGTGGCTATACAGATGCGTGGGAATGCGCTGATCTCCGGGTCTCGAGACCATACTCTACGTGCTTGGGACTTGCGTGCAACACC
GAAGAAGCGCAACATGTTCTCGTTCTTCTCCTTGTCTTCCACCAGTAGCAACACCATGAACTCGACCGAAGACAGTGAGGTAGATGGCGCGTCAGTATCC
AAGCGGAGTATCGTGATGCGTGGACATTTGGATGCAATCACGTGTATGGAGCTGGGACATCAGCTTGGAACTGGTCGCTCTTTGTTAGTTTCTGGCTCTG
ACGATGGTACAGTTCGGATATGGGAAACAACAAAAGAGAGCAGTGTAGCACTGTTAAGTGGACACAAAGCTACTGGCAAACCCGCAGACAATGGCGGAGT
AAGCTGTCTGCGTTTACTCTCAAGTGATGATGACTTGGCATTGGGTTATCGTCGTCGGACAGTGCAGATTTGGGATCTCGCAGTGTGTAAGCTAAAGGTT
AATGTGGAGGCTCACCAAGCTGGTGTACGGGACCTGCAGGTATCTGGCACCCGACTTGTGACGGCGGCGAATGATCGCGTTGTTAAGGTGTGGGATACAT
CCTTTCGAGGAACAGGGGGGCCTGTACATGCTGTGCAAGACTTATGTGGACATGGTGGCCCTGTTCAGTGTGTGAGTCTTGGAGGACCTGCAGATCCCAC
CATTTGCACTGGTGCAGCCGATGGTCTTGTTCGCGTTTGGGATCTTAGATATGTGCAGCGAGGACCACGATTAACACTGCGGGGTCACATAGGCCCGGTG
ACGCGTCTGCAGCGTGACTTCACGAAACTGGTGTCAGCAGGAGAAGACGGATGGTTGCGCGTTTGGGATATGCACTCGGGTTCGTGTCTTCGCGAGAAGA
AGGTGCACTCTTCTGGTGTCACTTGTCTTGAAATGCGTGATTCACTGGTGTATTCTGGCTCATGGGATGGCTCGGTGCGTGTGTGGGATATTGAGAATGT
CAATAGTTCTGGTCAAGCTGCGGTATAGCTCTACAATTTCCAGCTAGCCACGTGATGATAATATTGTTGGCTCACATGTTGAAGTGACAACGATGCATTT
CGACCAAAATGAAAAAGATAGTTGTCGAAGGAGGCAAAGTATTGCTCATCGATTTTGAAGACAACGAGACTACAACTTTTTGTGACCTGGCGAAGAGAAT
GATCGACTTCGCGAGCCCTACAAGTATACTGTGGGTGATCTGACGCTCTATTTGGCGAAGAGAGATGACGAATGGTTGCGAGATTACTCTTACGACGTCG
ACCTGCTTGTGCATGGCGAATTCCCAGACTCAATTAAGGCGCTACTAAAGGAGGACAGCAAGTGAACCTCGGGAACCTGATGTGCGACTTTGACTTTCGT
CGCAGGGCTGGCATGCCATATGACAAATATCACGTTATCCTGGACCCCCAGAGCGAATCAAGTGCCTGTATCGCCAACACCGACAGGAAGAACGACAATA
CATCGAAATAGTGCACCGAGCAGGTAGGATCAAACGCAAGCATCTTGTATTCACATTAACTCATGAAACTTGGATGCTGACACAGTTATGGCGCGTGAGG
CAAGACGAGCGTGCACAGTTGACCGTTCTGGGCCGGGATTCCTTATTGGTACGGCGCTGCTGTCGTCTTGGAAGTCGTTTGCTTCGTTTTCGACGCGAAC
ATCTCGCTGGCAACAATATTTGTTTCGCGGTGGTCGGCAACACGGCTTTACGAGGACGTAAGGATAAGTTAGTCCATTAAAGCCGGCGGCNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGAACATCTCGCTGGCAACAATATTTGTTTCGCGG
TGGTCGGCAACACGGCTTTACGAGGACGTAAGGATAAGTTAGTCCATTAAAGCCGGCGGCACTGTACGAAGAGCTACTAAGCGTGGTACAGTCCGTAAGG
CTTTGCGAACTACATCGTGCAGCAGATTTCCGTTTGCTATATTACAAGTCGAGATTAACATTAATCAATCAATATGCCGTTAATAACGTGCAAGCCACAC
GAATTTGGTAAGATCCACGGCAACATCGTGATATACTGAGAAAAATTGTTGTCGTCCAACTTGGGATAGTAATTTGGTGGGAATCTGGTGTTTTGCCGAC
GGAGATACGACGATAAACGCGTTGCTAATTCTACTTGGTTTATCCTGGGAGGACAGCTGTATAGCTGTATGGACAGCCTTACAGACATTAATTCGTCCCA
AAATGTCGCCTGAGACACAGGTAACATTCGACAAACATTCAAACGACATTCCATTAATACAGCATTCATACAACTACACGCAAAACGTCCCCCAAGCAAC
GTCATTGACTTGGCATGTGAAGCAGTGCAGCAGTGCACGACAAATACATGTATGAAATCCGCTGTTGTGATCATCACGCTGACTTCAGAAAGCAAAAAAC
TGCGCAAGTATCGTCGTCAAGACCACCGGAGAGCTTCTCGCCTAAGATCTCAACGCAAATGAACGCGCTGTTTTCGCTTGCCCTCATTGAACCATGAAAA
ATCTTGCACCAACTTGGTTCGTCGCAGCTTACGACGCCTGGCTCAGATGCGCAAAGCGTGATGGATGAGTGTCATTTCGGAGTCGATACGATCGCGCTGC
ATCGTCGACCCCATTGTAAAGTTTTCGTAGTTAACAACTGGTACTTCCACTGGTAGCCCTGGTATTGGATGCGGCTGGCCTATCTGCCAATGTAAGTTGC
GAAGCGCAACACGAGCAGTGTATGACTGATGAAGATCTGCACCCCTATCGGTACGGATATTTTGTCGTTGGAGCTCCAGCACAAATATTAGACAATGGCG
CTGGAAATTTGGCATGGGGGGGGGTTGCCAATGGAACGTTATGCTACATGCATTCACTGGGTTGGGATACAATTGACCAAGCGTCTGCTGCTCACAATGC
AATTCAAGACGCACTAGTTCATCACCGGACGTTGGTAGATTTGCCCAATCCACCTGAATTTATCAATGTCACACTTGTACAACCGAACGGAGCTGAAACA
AGTGGAGAAAAATGGCCTTCTGAGGCAAATTTGGAACATGAATTCGAAGTAAATTCTCGTGGAATCCGTCACAAACGACGCGTTATCATTCCGATAGGAC
TTCTTCCAGCCAAGGTCGACACTTGCTATGTTAAATTCTCTCAACTGAACGCTAAGATCGAGAAGCAGTATCAATACATCATGCACGCAGTCGATCTCGC
CTTCGTTCAAACGGTTTGGAAAGCTCAAGGTGCAACTCTAAAAAGAGTTGCGTTATTACTAGAGGATTCACAGCCGAAACCTGTTTGGGCATTCGAACAT
CTTTACGTCGGAACCACGCGCGTCCAGACTGCAGACGGACTTCGTTGTCTCCCTCTCACGTCTTCGTATAATCGGAACAAGCTACTTAGCTTACGTCCCA
ACATATACACAGTCAAGTGGTTGATGAGCATCGACGAAACGGTTTCTGGAAAGCAAGAGAATAATGGAATTCATTACCGTACATAATAAAAGAAAAAAAT
ATATTATTACTTAGTACTTTTTAACCTTTTCAGAAAAACAAAAGGTCCTCCCAGCCTAACGCTACGCACCCTTGTTAGCAGCAGCTGAACATGTGCAGTT
TTTAACTTCGTTTCGACACCAAGCGACACAAACATGCCCAGAGTGAATGAGTTATCTGCGCGATTGCTGCCATTGTCGCCGTTGTCATCACCTGGATCTT
CCTTACCCAGTGTTTATTCGCCGGGAACGGCAACGCGTGAGAAGCCACAATCTCGGCAAAGAAAGAAGAAAACGCAAAACTCCATGCTTCAAGCAACAAA
TTGTGAACAGACAAGCCAAGATGAAAACCATACCCAACCAATTACTAAATCGAATGGAGACGACATCAATGCCTGGCCAGTTCTTGTAGCTGTGCGCTGT
CGCCCTCGAAAACGTCGACGAGCTAAAAGTCGATTTGCTGCTGTTCAAGATGAGGACGAGGAAATACGACGTTCTGGTATCATAGATTCTAGCGATAGCA
GCGACGTCAGTAGTAGCAGCAACGAAAGGGGATATCACAGAGTTCAGCGGGGTGTATTCGAGTACCCTGCAAACAGAGACTATGACTACGCAGCAACCTA
CGACACAAAGATCCCACCGCCGCGTATGCAGCGTCCACGCCGCCTGTACGTGCAAGCTCATACCACTGGGAACAGCTCTGGTCGACGAAGCTTCGACTTC
GACTTCATCTTCCCGCCATGGACGAAACAACGTGAAGTGTACGACAAGTGCGTACGATCACAAATCGACCACGTTTTGCAGTCACAGCAGCGAGGACAAA
TGCAACACGCGACGCTTGTTGCTTACGGTCAAACTGGCACTGGTAAAACTTACACTATGGGCATGCTGAGCGATTTCTCGGACTACAAAGAGCAGGGATT
AATTCCACGAGCGATATCTCAAATTCTAGAGTTTGCAGACAGCGTGGAGAGCGAAGAAGATGGGCGGGAAACGGTAGTGACGTTGTCGTTTGTACAGATT
TACCTCGAGACAATCCAAGATCTTCTAGCTCTGCCTGGCACGGCTCGGGGAAAGCCACACTCTCGATCTGGCACTTCTAGCGGCGACCTACCTGTACGTC
AAGGACGTGACGGAGCATTCTACGTCGCCGATCTAAACGAGTACGAGATTTCGTCAATAGAAGACGCACATGCACTGCTCGAACTTGCGATGCGTAACCG
CGTCTTGGCTGCGACCACGAAAAACAAAACCTCGTCTCGTAGCCATACGCTGCTCACAATTTCGATCAAGTATCGTCGAGATACTAGCAGAAGCTGATAT
TCCTCCAGCGAAGAGGAAGACGATGAAATCAGCAATGCTGACGAAGGTGATCCCAATCAAGCGTCGACAATCTCGTTCGTAGACTTGGCTGGTTCCGAGC
GTGTGGATGGAGCGCTACATTTTCTTCGGGCCACTCGAGCTCGACAGGAGCAACGAATCCGTGAGGCGAAATTCATTAATCGTTCGCTGAGTGCGTTAGG
TGGTGTGATCGCTGCACTAGCGCAACCGAAACCTGATGCTACCGGATCGACTTCTGCGAATGTTTTGGCTCGGTTAAATCGTTCTTTTCAGGATAAAATG
CCGCATCCGGTCAGGAATGAGCAGGGGCAACCACATATCCGTTTTCGAGATTCGCAGCTTACAAAGTTACTGCAAGGGCGACTTATCGGTGGCCGTGGAC
GTCTACTGCTGATCGCGACTGTGGACGATCAAGCGAAAAATCTTTCAGAGACGCTATCGACTTTAAAGTTTGCATCGCAATGCCGTCGAGTGGAGCTTGA
AGAAGGATCAAGACTTGGTGGGGACAGGAATGATCGAGTGAGACGTCAAAAAGCTTTGCTTGACAAGGTGCTTAACGAAATGAAGAAAATGCACGAGAAC
CGGGAGGCAGCGCTGCATGTAGGTTGTGCATTTGGTATCGTGATCCAAGGGTTACTTATCTGCTCCTGTTTGCTTGATATGCAGAGTGAATACCAAGCGC
GAATTGAAGCTTTAGAACGCGAGTTAGAAAGTGTTCGAGCATCGGCTCAGTCGTTATCGTGCTCAACACCAGAAGATGTAGTACCCACGAATCTTGCATC
GTACACGGCACTCTGCTCACTAGTGGACGCTGTTTGTTCCATTGATGATGACGACGTTCAATGTAGAGAAAGCAAGCATCCAAAAGCTATCGATTTCCAG
ACCGAGAAGGATATGCTCGAGTACGTTGCTGGACTTTACAGTCGGCTGAAGGAAGCACTAGTTACGCAGCAGCAACTGGGGCGGCGCTTTTCCGCTCCAA
TAAATACAGGTGCTATTGGAATTGACACCAGAACAGGCTCCGTTTCATCACAACAGCCTTCCACGCACGATCAACATTACAATGTCGCCAAGCAATCACT
CCCTCTTCGGGCATCGGCTCAATCTTCCGACTCGACCAGGACAAGTACCCGGCGAGCACGCATTGAGTTGTCATCTGACCAAGAGACTGAGTTCCGTGCT
GTCGCTCGCCATCTAATACTGACGCGAGCTTTGGACTCTTTCGTTGTCAGCTCATCTGATGAAGATGAATAGACAAGCTTTGAAAATGCATCGAAACAAG
TCAAGAGCCAATTCATGTCGACCCATCTCATTGGTTTTCTTGTATTGTATCCCTCTTCTTTGCATGTAGTTGTAATTATGTTTGCTCGAGACAATGTGCA
ATGCCTCTCAGTCGACGTGAAAGTCACGTCACATGGACGAGCGCGACGCGATGAGCGTCATGGCGGCGGCTCGCGGGATCCGCAGCGACTTTTGTAGGTT
GGAGAGACACTGTTCGTGTAAGTAGTCGCGAAGCAGCGTCTTGAGTGAGCGACACGCGAACTGATAGAGTTGCTGGTAGCTCTCGGGCTGCGTGGCAAGC
TGTTGGGGCGACACGTGGAACTCCTGGAGGCACAGATTAAGCCACAGTGCGTCATCGTTGCTCAGGCGGTGCCAAGAGCGGCACACACTGCGTGCTGAGC
AGAGCGACGGGCCATCTAGGAAGCTCAGCACCACGTGGACGTTCTCGTCGCATGTGAAGTCCAAGAGGCTCAACGGGCGTCTAGGCTCGGCTATGGGGAC
GTCACAAGGGCTCAACGAGCGTAGCCACTCGGCCACGGCGCATGCTTCGGGCGACAGAGCGCCACCCACAGGGGCAACCAGTGGGTGGAGGATAATTGCA
CGAGATGTAGGGAGGCTCATTGCCTGGAGAAGAAGGGTGAAGTGCTACTCGCAGGGCCGCAACGGATGTCGAAGTTGCGATGATGCCGATTGAAGAATGA
TTATGGATGGGTGCGCCACATAAATTCAGTACCGGTATTTGAATGCTAATTGGTGTTTGAAACATTAGTTCACAGCCCACGGGTTTCAAATGCAATTTTA
GAAGGCCCGCGGGTCTAGATTAGCTTTGAAATTTGAACTGGTCCAATTGAGCTCGAGGGTCTTATTACAGCTTCGATGGCGGTCATGTCGCCGCAGCACG
CGGCCCCTTTCCTATCTCCCACACGCGGTGACGCCCTCAAGAAGCGACCGATGGCGTCACCAGCAACCGCGGTTGAGAAACCTCCCAAGACTCCCGGCAG
CGCCACCGTCGGCCGCAAGCGCAAGAGTCCCAGCGCCCAGCCAAGCAGCAATGCTACCACACCCGCCTCCAATAAGAAGAGGACGCGGCTGTCCATTGGC
ACGCCCGGCAAAGTGACACCATTGGCCGACGTACGTGAACGAGAAGTTGAGCGGACGTTCACAGAGCATGAGGTATCCGAGGTGTACAAGACCATCCGTA
AGCAGACTGGAAGTCTCGGTGGTAACGCAGCCGGTGGAGCCATCTACGGAGAGATCACCCAAGCGTCGTTCCAGAGGGTAGTTGACTATATGAAGGAGAA
CTGCGAACTCTCCAAGACCAGCCGATTCATTGATGTCGGCTCGGGACTGGGCAAGCCCAACTTCCACGTAGCTGTGGACCCTGGTGTGCAGGTTTCGTAC
GGCATCGAGCTCGAGGAGCTACGCTGGCATCTGTCGTTGCATAATCTACGCAGCGTATTGTCGCTGGACTCGCAACGCAAGAAGCCTCTTGCGACGGTAT
TTACAGCGGGGGATATCACCCACGCTCACTCGTTCGAACCCTTCTCGCATGTGTATAGTTTTGATGTGGGCTTCCCACCCGACGTGATGGACAAAATGGC
CGACATGTTCAACCGCAGTTCAGCTAAATACTTTGCCAGTTTCCATGCACCACGGAAGGTCGTGGACATGTATGGGTTTTCAGTAGAGAATATCGGACGA
GTGGCGACGTCGATGGCAGGTTCGAGTGAGGGACATCAGTGCTACTTCTATCGGCGTGTGGCGTCGACTGACGAGGAAAGTGAATCAGAGGACGATGAGG
TGTCGGTGAAGATGTCACCTCCAAATAATACCGCAAATGGCCCGCCGATGACGGTGGATCCTCTCTTTAGTAAGGGTATTGAACTTCTGAAGGGCGGCAG
TGAGGGTATGATCGAGTGGATTGCCGACTTCTTCGGCCAAGCGAACGCTGGACGCACTCGCAGACAAAAGCGTGAGCTGCGTGAGCGCCCGATGGACTCT
TACTACCCAACGGTCAAGTCACACGTAGCAGCGGGGCGGAAAAGCAACAGGAAGGTACCCAGGACAACCAAGCGCAAGATTAACCTTGGTGTCTAGACTG
CCGTGTTTGCAATTACGCTGGACCCTGCTGCCTGTTCACAAACGAAATTACTATAGTACAAGCACTGTTTACGTGTAGTTATGGGGAACACAAACAGATC
TATAGGAATACAAGCTGCATACATGCATTTTTACGCTCTATAGCCTTCTACTGCTCCGTGTCCTAGTTGCTATTGCTCTATTCTGTTGCTCGGCTAGCTT
CAACGGACTCGACGAAGAGTTTCTTTTGCAGTGGTGTGAAGATGTCGCCGCCTGCGTGGATGCAGGAGATTAAATAGGTCACATCTTTACTCTCGAAGCG
CTCCTCCTGACGGAACTGGTCTAGCTCGTCACCAAACGCAGTGGTGAACTCTTCCATGTACAGCTGTCGGAACTCGTTCTGCACGGTGGCGTCTCCTGCC
GAAGCCGATTCGCTTGACAAGTGTTCCTGTAGATCGTGCTCAGCCGACGCAAGCAGCTCGTGACTAGCATGTGCCGTCTTCCGTACGACACCCATACGCG
CGTACTTCTTGGCGGCGTCTTCCGCCTCGTCCCCAGCCGCTACGAGGTCCTGCAGCAGCAATGTGGTAGCTTCATCCTGTTCGTCCTCCTCACTCTCCAT
ATCTTCATCCTCACCGTGGTGACCATTTTGGCTGTGACTGTACGCATTCTTCAGCGTCTTTTGGAGTTTAGACAGCGTTGCAGTCGCCTCCAGACTCTTG
GCAATGAGTTCCGCACAACGGACGCATTTATCCGTGGCTTCACTAAGCAATATCTGTCTCTGTTCGTCGTTCTCAGTCCCCGTAACAGCTGCAGAGGCGT
CCTCCACTCGTGCGCACACTCCGCTAGAAGCCTTGAAGGCGTCCTCGCCCAGCGCCGCGATCAGGCGGTCATAGCGTGCCACAAGCCGTGCAGCCTTGTC
CTCCATGAATGTTTTGAGTGGCTGTGCCGAAAAAAAATGAGTCAATGGGTTGTTAAAACAAGGAAGTCCTTAATCGAAATGTTGTTTAATAGAGGGTAGA
TTTTTGCAAGAAAATTGACAAATGCACTTGCTTTGCTGTAATACAGTCCGCCGACCAGGTCAACCAAAGTCTTTGGTTCTAGAAGCAGCTTTACCACCCA
ACTGCACGGCTCACTTATCAAGTTGCAACAGACCACGAAGCTGTACGAAGGTGTCCGACAGTGTTCCTCTCGACACTTTTGCTGAGACACGACTTATTAG
CGGCGTTGAAGTGTTAGCTTCAGTCTAGAATTGGCCGTTTGAAACCTAAGCGGCAGTGAGTAGTAAGAGTGGAAGAAACGGCGCACCCAGTCGATGGATA
CCGCCAATCTGAGCTTGTCAAATATGACACTGGAGCTCACGTGGCTCGCGAACCAAGCGGGTCTCGCCACGTCCGACCTGTGGACGTGGCTACGCCTGCG
ACTCGCCGTGTTCACGCGCGTTGGTGCCAAGGCAGCGCACAAGACGTCTCGTTTGGCTGCCGACGTGCGCGGCCACGTCGAAGAGCAGAACCCGTATGCA
GTGGGCGGTGTAGCCACGCTGGTGGCCGTTGCGCTGTTGTTGGGCGTGCTGTTCATGTGGGTCGCATCCCGCCAGGTGCGGCCGCGTAAGACGCAGCCCA
AGGTGGAGAAGCCGCCGTCACCTACGACCAAGCGACTACGCCACAACTCAAGACACTCCAAGTCCTTCTCCGACCTGCTGCAAGCCGAGCGTGAGCGCAT
GCAGGAGAACCGCCAGTTGGAACTAGAAGACCATATCACGTTTCCCAAAGAGCTGCGGCAGAACTGCGGGCCCGAGAACCTCAAGTTTATTTATGATACA
CTGTCCAAGGTCTTTTCTTTTCTACGCGGTGAATTTGTGGAGCCTCTTGCACGAGATCTGCGTATCCTACGCTTCTCCAAAGGCGAGACTATCTTCGACA
AGGGCGAACTCGACGGCTCTATCCTCATGGTCGTCAACGGGTCAGCGTCACTGACGATCCATGGCGAGAATGAAGATCAGCGCTTTGCTAAGCTCTTGGG
ATGCGGTGATACACTCACGTCATCGTTGCCATTGCTCACGGTGCTTGTGAATGAGTTACAGAACGGAGAGTGCAGCGCTCAGGTGAAGAAAGTATGCGGC
AGCTTGTCTGCACGAGCTGAAGAAGACGGCACGCGGCTGTTTAAGA