Description :
From Genome Similarity Track
Location :
Scaffold_121:67511- 70983
Transcript NameFunction/comments
Phyci_356263nucleolar protein NOP5

Sequence
3472 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAGTCAGCGGGCTTCACGTCGCGCACGGT
CACGCCGCGCGTCACTTCTTCCTCGTCGTAGTCAGCCATGTTGGAGTCTGTGGGCAGGGCGGGGGCAGGGGGCACGACACAGGTTAAGAACACGTCTGTA
CCACCGCACTCCGGGCGGGACTCAACGCATGGTCGAGTCCGCGTCAGTCGCGCAGGACAGTCTCGGTCTTAAGACACATCGTTACTACGGAACGACTCAT
CCCACAGCGCTACGACGACTAATCCCAGCGAGCACGTGCGCGCAAGCAGGCAGGGGAGGGGGCACGTACTTGTTAGGAGAGGAACTTTGCAACAAATGCC
GAGCTCGGAGCCTTGCGCGCTGGCCGCCCCAGAAGCCCCTCCACCAGTGAAGCCGCCTGCGCCTTTTCGGCCAATCGCCGGGCCGCAAGCCGCAAATAGG
GGCCGTGGCCAGTCGATGCGATCGGATTCGGCGGGGCGCATGCCGGATCGCAGGCTGGCATGCTAGATCGCAGGTCTGAGCGCTGCGCAGCCATTGGCTG
GCCATCGGCTGGCCACCACCGACCGCCACGCGCAGGACCAGTCGCGAATCGCTTGCCGCCCGCGAAGACACTTCAGGCAACTTAAGGATGTTGGTTCTGT
TCGAGACGGCCGCGGGCCACGCGCTGTTCAAGGTGCAGGATGAGGCCAAGGTGGCCAGCGCCGACGACGTGTACAAGCACTTCGCCACGCCCGAGAAGGC
GGCCAAGGTGCTGAAGCTCAAGGGCTTCAATGCCTTCAAGGACACGACCGAGGCCGTGGCCGCCGCCACCGACATGGTGGACGGCAAGATGGGCAAGACG
CTCAAGAAGTTCCTCAAGAAGAACGTGGTGGACGCCGGCCTGAAGGACAAGCTGGCCGTGTCGGATAAGGCGCTCGGCTCGCTCATCAAGGACAAGCTCA
ACATCGCCTGTGTCAACGACAGCGCCGTGAACGAGGTCATGCGCGGCATCCGCGCCAACATGGACACGCTCATCACGGGCCTGGAGGACGACGACCTCAA
GGCCATGACGCTCGGCCTGTCGCACTCGCTCTCGCGCTACAAACTCAAGTTCAGCGCCGACAAGGTGGACACCATGATCGTGCAGGCCATCGGCCTCCTG
GACGAGCTGGACAAGGAGATCAACACGTACTCGATGCGCGTGCGCGAGTGGTTCGGCTGGCACTTCCCCGAGATGGGCAAGATCGTCACGGACAACCTGC
AGTACGCCAAGTGCGTGCTCAAGATGGGCGTGCGCTCCAAGGTCAAGAGCCTCGACTTCTCGGACATCCTGTCGGAGGACGTGGAGGCCTCCATGCGCGA
GGTGTGCGAGGTGTCCATGGGCACGGACATCTCCGAGGAGGACGTGACCAACATCTCTGCTCTGTGTGAGCAGGTCATCTCCCTCACGGAGTACCGCGCT
CAGCTTTTCGACTACCTGAAGAACCGCATGAACGCCATCGCCCCCAACCTCACGGTGATGGTGGGCGAGCTGGTGGGCGCTCGTCTTATTGCCCACGCCG
GTAGCCTGATGAACCTGGCCAAACACCCGGCCTCGACTGTTCAGATCCTTGGTGCCGAGAAGGCTCTGTTCCGTGCCCTCAAGACCAAGCACGACACCCC
CAAGTACGGTCTGATCTACCACGCTTCGCTGATCGGCCAGACCGCCCCCAAGCACAAGGGTAAGATCTCGCGTGTGCTGGCCGCCAAGACGGCGCTGGCT
GTGCGTGTGGACGCCCTTGGCGACGCCACTGAGGCGACCATCGGCTTCGACAACCGCGCTAAGGTGGAGGCCCGCGTGCGACAGCTGGAGAACGGCTTCT
CGGGCATCCCCAACAGCAACGGCAAGACCAAGAACGAGTCTAAGAAGTACGTCAAGACCGAGACCAGCTCCT