Description :
From Genome Similarity Track
Location :
Scaffold_706:6751- 8312
Transcript NameFunction/comments
Phymu_g11646hypothetical protein

Sequence
1561 bases(100 bases per row)
GGTGCGTtgcgagaaggtggagctcCCAATCTCTTCACTGAGCAATACGTCGGTGTTGTGCTGCAGTATGCTGCTGTTGGGCTTGTGTATGGCGTGTTGC
CATCCACAATATATCCATTCCTGCAAGTGTACCTTAATGCCAGTGGCACACAAGTGGTTACCGCTGGCACTCTCGTGGTGCTTCCCTGGAGCTTCAAAGT
GTTTTTCGGAGTTTTCTCTGACTGTTTCCCGATCTTCGGCTACCGCCGCCGGCCGTACATGGTCATCGGGTGGACGATCTGCGTGGCGATGCTGTTGGCT
ATGGGCTGTACCCGTGTTGGTCAAGCTTACTTCATGGAGCCTTTGGATCGAGAGATTTCCCCTGCTGACTACACTTTTGAGGTCGAAGCGAGGTTGAACC
GGAACGCAGCTAACGAAGGCAGTATCTACGTAGTCCTCATGATGTTTGCAGCCTGCGGATACGTTTTGGCCGATGTGTGTGCCGACGGTATCGTGGTGGA
ACTGGCGCAGCGAGAACCGTTGACCGAGCGAGGACGAACCCAATCCACAGTCTACGCTACGCGAACGTTAGCCGCCACGATGGGTCAGATTCTGACGGGT
GTTGCATTCAATGGCGAGGAATACGGAGGTTCGTTTGACTTTTCACTCTCGTTCCCTCAGCTCATGCTGGtgcttgctgcttgctcgGCCCCGATCATCC
CCGTTACGTGGCTTTACGTTGACGAGTCGTGTACAGCCCCAGTCAAGTTCTCGAACTATGTGCGGGAGTTATGGCAGGCCATGAAGACACGTGCAGTCTA
CCAGGTCGTCTTCTACTCGTTTTTCAGCGGCATCTTGGCAAACTTTTCGTACACTGCGGGCTCTCCGATCCAGTTGTACATGGTGGGAGTCTCGCCTATC
AACAATACTATCAGTGATATCGTGGGCAACGCCGTGTTCTTGGGCGGCATCGTTCTTACAGGTAAGTACGGACtcaactggaactggcggaCGATGACTG
TGCTCACGGGAGTGACGGTCCTCGTCGTTGATGCGGTGTGTACGTTTGTCACTGTGTGGGGTGTCTTTCGGTCGCAATGGTTCTGGCTGGGCCTTCCTAT
TGCTGTCAACATCCCGGCCGGTATTAGCTTCCTCATTGGCACGTTCGTAACCGTGGAGCTGGTTGGCGAAGGCCATGAGGGCGCCATGTACGGTCTGTTG
ACGACTGTGGCGAATCTATCGTCTCCCTTTGCAGCTACACTAACGAAAGTGGTCGACAGCAGTTTGTGGGACCTCAGTAATGAGCGAGTGCAAGTGGACG
ACTACGCGGTGCGTCGTGACATTACAGAGGCAGTGTTGCTCATGTACGGGATGAGTGTCGTTTCGTGGCTTTTCCTTTTCCTACTACCTAggcagaagga
ggagacgcagcagctcaagcaacGAGGTGGATCAAGCGCGGTGTTTGGGTCGCTGACCGTGGGTTACCTTGTTGTTGCCTTGCTATGGTCTGTCACGACA
AATTTGCTAGGGATTTTCCCAAGCACAAGTTGTTTCGGGGTCGCTGGGGGAAATGGCTGCT