Description :
From Genome Similarity Track
Location :
Scaffold_92:67502- 70212
Transcript NameFunction/comments
Hyaar_Emoy2808987hypothetical protein

Sequence
2710 bases(100 bases per row)
TACTGGTCTTGTAGTTTATAGTCATTAACAGCACTAATGAATTCCTGCAATATCACTAAAATGTCTCCATCAGCACTGGTAAGACTGTAAATCCGGTTTC
ATATTGCCTATAATCATACATTCATATTGTACACAGCTTAGTGCTTTCTATAAGCTAAAACGTAACTATCTTATCTTACTCGTACGAAATGACATGTCCG
TGGCACATATTTATGATCAATCCAAAAGGTCCGGACGAAATCGATAAAGCAACGTTTTCGCACAAAAAACGACAAACAACACAGAATATGCTTGAGGCAT
CATTGTACCTCCCCTGCTTGCAATAAACCCGCAGAGGAAGAAGTACGAAAGCTTTCAGATTAATAAAAAGAGAAAAACAGATATAATGGATTAATAGTTG
TCTTTTGCCTTGGTTAAATATGCTTAAGTAACTATATCAAAAATCAACCGGAGCAAATTACGATCCTACAACTAATTCAACTACAACAGCAAAACTTCTG
TGTTACCAACAACAGTAAAAGCAGTAACACCAAGAACACTTACAGCATTATAACGGCATCAGCAGCTCAAATAACAGTAACAGCAGCAGCGAAAACAACA
ACAGAAGCATCAATAACAAAAGCAAAAATAAAAACATCAACAACAGCAACAACACCACAAACACCAGCACCAGCAGTAACAAAAGCACGGGACAACATAA
ATAACTTACAACAACAACAGCTACAGCAACAGCATTAGAAGCAACAACGACACCAGCAACAAAAACCGCAGCAACTGATACAACACAACAGTAATAATAA
TAAAAATAATAACAGTTGAAAACAATAATAACAAAAATACAAATTGCGATAAAACAATAATAGCATCAACAACATTAGCACCGAGTGTCCATTTATACAA
TCTCGGCCGACGACATGTAGAAGCGTTTACGTCTTTCCTTTGCCGTCTGCGGACCAAATGATGGCTACGAGTGCAGCGTGCCTGCAGCAGAAACCCCTCC
GCGGCTTCCCCTCCAGGGAGGGGGTTGAGCACGACCGTCCAATGGTTTTTGAGAAATGATTAAACATGCGGGCTTTTATGTGTATCACGTTAACTTGAGT
ATAACGGGACGTAGAGGATTTTATTTTCTCATTATCTGAGGCATTTTCTTGATTTCCCTTAATTTAAATAAAGTGTGTAATGTATAGGGTGAAGTCTCAT
TGGCGAAAAGTGAAGGCTTATTAGCCACTCCTTTTTGGCCTCTGTTTTTATTAGAACTTAAAATCACCGATTTCCACAATGCAACAGACGCTGAAACTAA
AGCAATTGAGGCCCACAAAACGAAAAATTTCGAATTCAGGTAATATCCAACACTAAATCGTGTAATCGCACGAAGTGAATTAAAGTACAACGTAAGGGAG
CTTGAACAAAATACCACATGATCAGTAAGCGGATATCTAAGTGTTTTGATGTTAGGTCGCGCGTAAGAGCAACCGCCACCGGAAATCAACACACGATATC
GGCTTTAACACCGGCGGTAAGAAGGAGGGGAATGAGACGACGTCAAGAAAGTTGCACAGGGCTGCGTTGTAAGTAGGCGGAGTATCGCTTGATGCTAAAT
TTTTATAAAGAAAATGTAAATTGAGGTTCGATCAGAGAGCCCAGGTTGACCTGTCTGACTTGGCTAGTCTCAAAATAGCTAGAACTTTGTATCGATGCAC
TCAGAGCAATTGACGAAGTCAATCCGACAAACATTGACTGAGATAATGTTGACATCGTCACTACAGCTGTGTGAAAAGGTGGTCGTTACAAACGATTTTG
TCTAAATATTTCGAGTCAGAAGCTTTAAATGCTAGCAAATGCGTGATCGAAAACACGACTGATCCAATGTGCACATCCATATTTGTATATGGTTTATGTT
AAACAGTACCCAATTACTATACACACGTATACAATTTTTTTCTTGTTAGTCTTACATCCGACGGATGCACCTTTATAGTAGCGGTAAGGTCGTTTCCACA
AGAGAAGATGTTTTATGGAATAGTCGTTAAGTACGAGGTAGGTCCCTAACATGATATCTGTTTCATTCTCGCTTTATTTTATACAAGAAAGCTTGAATAA
AAGTAGACGTTTTCTCAAATCTGTTATCAGTCTTTCGCACTCAGAAGGATAAAGCGCCGGCATCTTCGCCCATCCCGCATTCGGTATACTACAGAAGGCA
CATAAACATAAAATTTGTACGCTGGTCGATTAAGCCACAAAAAAGGCAAAGACGTCTTCTATGTAAATATGCTTTAATATGTGAAGTTCATCAGCGTCAT
TAACAATCAAAAATCGGCATCGAGTAAATTACGAGTAAGATTGAGCAAAACAATATAGTATCTTGTCTTTGTCAAGATCCGCGATATTTCCTGACATAGA
TTGATCAATCAGAGAAGTCTTGTACTCCTTAATTTGCTTCATCGTAGATGTCGATATTGAGCACGCGGGTCCTATTTAGAAGAATCAAGTGTTGCGCAGA
CGTCTTCCAATCGCTGTTCGTTCGACATCAAAACAGAGATCCAATTTGACCTGACAGTAGTGCTGTTCGTGACTAACGAGTGCATAACCTTATAAGTGTG
AGGAGACCCTGGAATTAAAATGCGCTCTTGATCTTTCGAAGGAGCTATTCAAGTTTAGTAGCTGAGTAGAGTAGATTTGTAAATAGCGACGTAGTGTGTA
ATCATTAAAC