Description :
From Genome Similarity Track
Location :
Scaffold_480:675- 1945
Transcript NameFunction/comments
g6777.t1XP_009519712.1 hypothetical protein PHYSODRAFT_480010 [Phytophthora sojae

Sequence
1270 bases(100 bases per row)
CTCGATGCGCACCTTGTTGGCCTCGTCCTCCGACTTGTACTTCTCGGCCTCCGCCACCATGCGGTCGATATCGGACTGCGACAGTCGGCCCTTGTCGTTC
GTGATGGTGATCTTGTTCTCCTTGCCCGTCGACTTCTCCACGGCCGACACGTTCAGGATCCCGTTCGCGTCGATGTCGAACGTCACATCAATCTGGGGAA
CACCACGAGGCATGGGCGGGATGGCGTCCAGGTTGAACTTGCCCAGAAGATGATTGTCACGGGTCATCGAGCGCTCGCCCTCGAACACCTGGATGAGCAC
ACCAGGTTGGTTGTCCGCGTACGTCGAGAACGTCTGCGCCTTCTTGGTAGGCACCGTCGTGTTACGCGCGATCAGCGTCGTCATGACACCGCCTGCCGTC
TCCAGGCCCAGAGACAGCGGCGTCACGTCCAACAGCAACAGGTCCTGCAGCTTGTCCGACGAGTCGTTGCCGCCCAGGATGGCCGCCTGCACCGTTGCGC
CGTACGCTACGGCCTCGTCCGGGTTGATGGACTTGTTGGGCTCCTTGCCGTTGAAGAACTCAGACAGCAGTTGCTGCACCTTCGGGATACGCGTCGAGCC
GCCCACTAGCACCACCTCGTTCACCTGGCTCTTGGACAGCTTGGCGTCGCGCAACACCTTCTCCACGGGCTCCATGGTCTTTCGGAAGTAGTCGCCGCAC
AGGTCCTCGAAACGGGCGCGCGTGATGGTCGAGTTGAAGTCCACGCCGTCGTACAGCGAGTCGATTTCAATGTAGGCCTGGGCCGACGACGACAGCGTCC
GCTTGGCGCGCTCGCACGCCGTACGCAGACGCCGCAGCGCGCGTTGGTTCTGTGCCATGTCCTTGCGGTGTTTGCGCTTGAACTCCTGCACGAAGAACTC
GACGAGGCGGTTGTCGAAGTCCTCGCCGCCCAGGTGCGTGTCGCCAGCGGTGGCCTTCACCTCGAAGATGCCCTCCTCAATGGACAGCAGCGACACATCG
AAGGTGCCGCCGCCCAGGTCGAAGATCAGCACGTTGCGCTCGCCGCCCTTCTTGTCCAGGCCGTACGCAATAGCGGCGGCCGTGGGCTCGTTGATGATAC
GCAGCACGTTCAGCCCGGCGATGGCACCGGCGTCCTTGGTGGCCTGGCGCTGCGAGTCGTTGAAGTAGGCCGGTACCGTGATGACGGCGTTCTTGACCTC
CTTGCCGATGAAGGCCTCGGCCACCTCGCGCATCTTGATGAGCACCATGGACGAGATCTCCTCGGTGGCG