Description :
From Genome Similarity Track
Location :
Scaffold_72:67490- 69553
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_72-fgenesh-gene-0.28Transcription elongation factor B polypeptide 1
Pytap_DAOMBR444maker-pag1_scaffold_72-snap-gene-0.71Enhancer of rudimentary homolog
Pytap_DAOMBR444maker-pag1_scaffold_72-snap-gene-0.51Intraflagellar Transport Protein 52

Sequence
2063 bases(100 bases per row)
TCTTTCTTATCACTACTCAGCACGCTGCTTCGCGCATGCCTCTGGTACATATTGACGCATAGACGCACCGCTGAGCATGGCGCgAaTTGTGCCCGAGACt
ATGGCGCATTTCTTGCTGATGTAGAACTCGTGGCCTTcGGCGCTGATATGACAGCATGGACCTCAGCCCTCAGGCCTCAATAGAAGCtCGCCGACGCGGC
GATCGAGAGCCCTGTGCATGCGCTACaTACCTGATCAGCTTCACCATCTCACTCGCGCTGTCGGCCGCGTCTTGTGCCATCGctCTCCGCCCCTGGCCgt
CACTcgAGCACTTGAcgtCGTCGGGACGAGTGACAACGGATACAATCGCTCTTCTcACCCCTGTGGAAACCGATATATACATTCCCcAaGTCAAATAACC
AAGAGGCGCGAAGAGCTACTCCACTAGATCCGCAGTGGCGCCAATGCCACAGCACTCGCAAGGGTGACGAGAGCGGCTGCTGCTAGCGTGcGTACTCGCA
TCCAaCATGGTGACAAGTGCATTCGACGCGTCACTGGCTGTTTTGTGGGGGCTGACGGCCGTGCTGGTGATCGCCAAGATCTCGCAGCACAAGCCACACA
TGTTCGCTACACTTACGTTTGGCGTCATGATCACTTTGCAATATTACTACGTCTACCAGGCAGCCAGGAAGGAGTTGGCCATGAGGATTGCGCGAGGATT
GTAGCGAGATAAGGCCGAGGTCGGTGGGTGCTTCCAGCGAGGCGcGGGGgCGATAAAGAACCTACACTCAACAGCAAGGAAGCACAGTCTTCAAaCGACC
GAGTGAAGACAAGTAcGGTGCTTTGCGTTCGACCATGAACCCCTTTGGTATCTAACGGTTGCGTATTGCTCGTTCATATTGACAATGCACGCAAAGATCG
CAACTGCGCGCGAAATGGGTACACGAATCCAGCGAACGCTTGCTTAACCGGCCTGGTTCTTAAGAACCTGGAAGACCTTCTTCTTGATCCACTCCTTGCC
GCACGGCAGGTATGTCTTGGTTTCCAGATCCAGTCTaTGGGGAGGGGCACATAAAGAAGAGAGAATATCAGTCCTCGTCACTATGACCAACGCGaCGATC
GCCTGATTTGAGACGTACACGAGCGCACTGAGGTCTGTAAGCGAGTCGATGTAGTTGTAGAGATCCTGGATGTCGTACGTGATGTTCTTGACATTGGGGT
TGAGCTGCTTGAGTTTGGCTTCATACATCTTTACGACGCCATCCATGCCAGCGTTGACCGACTCAAAGTCGAGGTACGTGCGCGAGTTGGGGTCGCGCGT
GTACTGCACAAGCAGGATCGTGTGCTTGGCTTGACGGAATtCCGCCTGTGCATCGCATGCGCTCCTCAGTCCCTCGTCCATGCGGCGCCACGCGTGCCTT
CTTCCCGTACCATGCTGCCCAAGTGACTTGACTCCTAAAGTGAGTGGCTTGATTCCACAAAGTTCCCcAAAACCCGAAAGAAtcGCACTGCCGAATAGGA
TGTCATAAGGCGCTCGAAGCGTACGTCTATGTGGACCACATGGGTCTTAATGAGTTgTTtGAGGTTTTGAGGTTTTATAGCACTGAtGCTGCCGCTTCAC
GTCCTTTGGCGCATCTTGGGCAGACGCCACTACGAGGAAGCATCCGGTCGCGTGCAAGCCGCCGTTTTCTCGACGACACGGCGACTCTCGCTTCTGAAGa
GTCACTTAGTGTGCAGTagAGTGGTaTTtGCATCCAGTAGAAGCGGGaGGgaCcTGAaCGGCGGAttcGCGGgCgTGggAGACCAAGTTGAAGTGGCCCA
ACaTgAaCGATGACACgCGATCAAACCGCAAGGGCagAACTGACCAGgCAGAGAAACCTGTAGTCGTGCTGTTcGATGCATCCAAGAAAGAAGCCTACTA
CCCAACAAGTGGCATGAAGAAGCTGGCACGAAAGcTCAAGGCCACAgCAAAAaTCGACACCAACAAAGACGATCTGTCCAAGGACCGGATAAAGGATGCG
AGTCTCATCGTGTTTGCTGGTGTTCGAGAGCGATTCAGCTCCTCAGAGTTTACGACACTAAAG