Description :
From Genome Similarity Track
Location :
scaffold_121:6749- 9252
Transcript NameFunction/comments
g4033.t1 callose synthase, putative
g4034.t1hypothetical protein

Sequence
2503 bases(100 bases per row)
GGCTGGAGTCGAGCTCGATGGCACTGATTGGAATCTGTCTAGCCTCAGCTGGTATCGCCATGCTCTCGCTCGTGTGCCCCCTTTACAATTTCGAGATCAA
CATGCAGGGCTGGAAGGGCAAGGGCGTACTGATGTTCCTCACCAGCGCTGCGCTGGGTTACATGATCGAGGCGGTGCTCATTAACGACATCAACGCAACG
ACGATGTCCAAAGACTGGGGCAACTCTCCGTACCACGACTGGCAGTGGCAGTTCATCTTTGGTATCATCCCCATCGTGCTGCTTGTGCCAAGTATGTTCT
TCCTGCCTGAGAGCCACTTCTGGGAGTACCGTCGTAAGAACGACCCGAAGGCGGCCGAGGCAACACTGGTTCGCCTGCGTCAGCGCCATGATGTGATGGA
GGAAGTGAATGAGCTGAAGGACTCCTTCGTGGTCAAGGAGGGTCGTGTAAACGTCCCGTTCCGTATCGTGTTGGTGATTGTGCTCCAGGCTACCTTTGCT
CTGTTCACATCGGGCGCGTTGTTGCACCGTGTGCTTGTCCAGCCTTCTCCTAGCCAGGCTGGTGCCCAGACATCGAAGTGGCAGATCTACTATGGTATCA
TGACGTTCGTGGGTGCTGTGCTGAGTCTGCTGACGGTGGACAACCTCCGCCGCAAGACGATCTTCAAGGACGTGCTTCCGTTCTCAGCGGCGCTTTCAGT
GGCATGCGGCGCGCTGGGACTCGCTGATCAGGAGGACAGCATCATCACGCAGATCCTGGTCTTCGTGGCGTTTGTCAGCGGCGCGTTGAGTCTCATTTGC
GGAACTTGGATCACCGCAATCGAGGTCTTCCCTCCGTACCAGAACGGACGATACATCATCATGTCCTTCGTGGTGTACTACGCGGTGCAGGCTGCGATCT
ACGTGGTGGAGCCCTCGTTCGCTACCAGCCACTTGATCTTCGCCGGTCTGTGTCTGCTGCTCACAGTCTTCATGTTCGTGGTGTGCGCCAGCTCCAAGTA
CGGCGCCATCGAGCTCAAGAGCGAGAAGAAGATGCGCAAGGACGCTGAGGCCGCGCGCAACAGGCCGTCGTTTGTGGCGCGTGTGTCCCGATCCCAGAGC
TTCCTTCGCTCGCGTTCAAACGTGCGTCGCTCGTCGTCGCACTACTCGGCAGCAGCTCTGACTCCGCAGGAGGGAAGCTACTCGAACTTCGAGTCTCCCG
CTGGACTGAACGTCAACGGCGGCACCCGTCGAACACTTAACGGCTCTCAGGCATTGTAGAAAGTCGTTAGTCAATCTTCTCCACTGGAGAAACACAAGAG
AGAAAGAGAAGTAACGCAAGCTTTTATATATGGCATTGATGCATTGTTGACGGTCAAGTTGAAGTCAGCAGGATACTGCTTTCGTATTGGCTGTTCGATC
CCTCATTTTCAGCCAATGACTATGCTCATATCTTTCTGAGAAGCCAAAGTTCAAGAGACGATGGAGGCGGAGGAGCTGCAACCAGCGCATGTGGACGCGG
CTGTGGAGAGCTCCAGCGCCGACACAAGCGACTTAGGGCCAAGCGAAGATGTCTCTGCACCTGTCACTGAAGATTCTGCGTCCGTTGCGCAGTCCGAAGC
CACGAGAGTCGAAGCTGAAGCCTGGGGAACAGGAGATGACGAAGACGGCTGGATGCCCAAGCCCGCGCGGCTCCATTCAGGCCGAACGCGATCCTGCGCG
GTGTGTTTCGTCTCGTTACAGTACACAGCTGCTGCCAGTTGGGATGAATACCTGCAGAGCGAGGGATATCTGCAGCAATTACAGGCAAACGTCCTGCAGG
ACGGGTTTATCTCGTCCTTAATCTGCGGAGAGAACACAGCAGGTGACCTGCCCACGGAGCACCGGATGCATAAGAACAGGAAGTACAAGTGCCGCCAGAG
TGTGACGGATTACAGAAACATGACAAGCGCAGGAGTCGTGGACAAGTCGGGAATGGAGAAAGGCTCCATCAGAACCTTGGAGGAGATGCTCATTGAGGCT
CTACCTACTCCAGTGTTCACCCACGTGCTGGAGAGGAGACTGGCGGTCCTTTCACACAGTTCCAAGATCGCCTGTGAGCTAATGAGTCATGACGGAGTGA
AGAAAATCCCTCGACCCGTGGAAAGTGCTCCGGGAAACGAGGAACTGCACCATTTAGCCATCCATACCCTCGGGGCTTTGCTGGGAGCCTTCGACTATAA
CAACCCTCAGGCATTGAAGTCATTCCAAGAGCTGTCGCACCTGTTGACACGCTTCCCCGTGCTTTCGTTGTATTCGTTCTGGAGTCCGACCAAGAAACCA
CCGGACAAAGCGTTGCTGTTTGACAGAGAAGCAGTGGATGCGACATCGGTAACTACGAGTTTGGACTCACATGGAGCTTATTGCGCAGTTGATGGAGTGA
AGAATACGTTCTGGCAGTCGCAACCTAGACCAGGCGTTGTGAACTTTGTAGTGAGGTCCACGGAGTTGAGTAAGGTCACGTCGATTGCGATCCATTGGCA
TAT