Description :
From Genome Similarity Track
Location :
scaffold_90:67484- 69270
Sequence
1786 bases(100 bases per row)
CTTCCCGTCGTCACCGACCTACGAAGATTTCCCACACACAGATCGCCATTCCAGCAAATACTGCACGCTCGTACTTCCCGCAATCCGGTCTCACGCAATC
TCAGCCCGTAGTGGACTTCCGCGTACGTTGCCCATCAACCTCGAGAGGATCGTATACCGGAGAGTCAAATGATAATGACGGCGATGGCGACATCGCGCTA
GCTGACAACGAAGAAGAATCGGGTGGATATGCGAGCGATTTTGGTAGCAACTACACCGGTGGAGTCTATAACCTCGGCATATACAACATCAACAATCTCA
CCAGCGAGGAGTCTACCCAAACCACGCAGTCAGATCAGACCACAGCGTAACGAAACGTTCAGCAGCGATTTGGTCCTGAAGAAGATTATCTTCATGCTGT
TCAAGTGAATGTGGATGCACCATACGCTTCCAAGCATGGGGAAATTGACAAAAAATGACAGGCTGTCGCGAACAAGCTTAACAAGTGCCCGAATTTCAAC
ATGAAAAATATTAAAGGATCAACCGCTAAGGCCAGATTTAAGAATCTGCAGACAAAGCACCGTACGTGGGAGACTGAGTCTGCGATCAAATCAGACACTT
ATGAGCGTGAAACTCTTTTTATTCAAATTATGACCAAGATTATGGCCAGTGTCGACGAATGCGAAGCTGGAGTTGTTGACGCAGCAGAAGTTAAGGAATA
AGAGAAGCGCACCAAGGAACATTCAGGTGAAGTAGTGCGACAGGCCGCTCTACCCCGAATTCAGCTTGGAAGGCGTTGAATAAGGACTAGCGATGATGAT
ACTGAAATGAAGGATCAAGAACCTTCACCTGTAGAGCTCCATCAATCTACCCGGACCAGATGGCCTGCTGACTGGATGTCCTTGCTGATGGAGACCAAGG
AACAGCGAAACCAGCTCATGAAAGAATTTGTCAACACAAAGAGACTGATTTGAAACAACGACTCGAATTCGAGAGAGAGGAGCGCAAAAAAGAAAGAGAA
GAGCGTCGTTTGGAGAGAGAGGAATACCAAAAAGAACGGGACACATAGACGCAATTGATTAACATGTTACTAAACGACTTGACAAGAGTTACAGTTAATT
TGCAGTCGATATTCGGATCTGAAAAGGCTTGCGGAAGTAATCATCCAATGTTGGTGGAGCGCACTTGAAGTACTAGCTAATTTGATTTCCGTTTCTCATG
CATGTCCATGCGTTACTAAGCAGTACTGCAACTCGAACCATTTGCGCCACAGGTGTTAGTAGAATTTGGTGGGTTTTGTTCCAATCTAGAAATGCTCATT
TCTTCTTGCCAACACCGAATAACCACTCAATCGAAACAGGGATTGCATGCATGCGATCCCTGTCAAACTTTGATTAGAGCTGAATCGAACAGTTGCATCC
AATATTCGACAAACCACGAACCTCGAAACAAAACGTTACCTCGTTTTTCGTTTGTTGAATATGGTTAAGAGAATATCCCATAAACCATATCCAATGAGGC
TTCGAAAGGCATCTATTAAATTCAATAATTACATTTTACTGATTGTTATTACGTTAATAAAATAATAAGTATGTAATTAAATAACACTGCACTCACGTCT
TCTCGAACTGGGGATTCTCTTCGAACTGGGGATTCTCTTCGAACTGAGGATTCTCTTCGACGAAGGTGATTTCAAACAAATAGGTCTCCGCAGTCAAGAA
AGATTGGGGTGGGTTCGCGAAGCATTTTAAAGCGCGTTTTGTTAGGCATAAGATTGGAGTCCCCGTTGTTGCTGCGCTACGGATCT