Description :
From Genome Similarity Track
Location :
contig_8:67484- 69174
Transcript NameFunction/comments
g1558.t1hypothetical protein

Sequence
1690 bases(100 bases per row)
TCTGGGATGAGCGTCCGCGCAAGTACAAGAACGTGCTGTTCCAGGTGTGCGTCTTCATCCTCATGATGGAGCTGTCGGAGCGTCTCAGCTACTACGGCAT
CAACCAAGGCCTCAAGAACTTCATGCAGAAGATCGGCTGGAGCCTCGTGTCCGCCAGCGCCTTGAAGAGCACGTGGACGTCCATCTGCTACATCACGCCG
CTGTTCGGCGCGTACCTGGCCGACGAGAAGTGGGGTCGCTTCCGCACCATCCTGACCTTCGGTGTTTGGTACTGCGTGGGCGACTTCCTCGTGGCCATCG
CGGCTCACCCGGACATCATGACGGAGGAGGCCATCGTGAACCCAATCTTCGTTATGGCTTGTTCGTGGGCATCGGCGTCGGAACGGGTGCCATCAAGTCC
AACGTGATCACGTTCGGAGCCGACCAGTTCGACCCGAACGACCCGAGTGAAGTGCACCAGAAGGCGACGTACTTCTCCTACTTCTACTTCTGCATCAACT
TCGGCGCCGCCTTCTCGTACGGATACCTGTCGGTGCTGTGCGTTGACGGCTCTGCTCAGATCCCTGCCGAGTACGGCTACTTCGCCACCTACATGATCTG
TGCGGCGGTGATGGTCGTGGCCATCGTCTTCTTCATCATTGGCTCGCCGCGCTACGTGCACATGCCGCCCAAGGACCGCACGATCTCGACGCTGCTGCGT
CTGCTCAAGCAGAGTGCACGCACGTCTCGCAACGGTGCGCTTGTCGTCACTGGTGCGCTGCTGCTCTTGTTCTCGCTGGCCGTCAACATCGCGTCGGCTT
TCAGTGCCGACAGCGGTCGCGTGGGCGAAGCGCTCTCGTACGTGGCAGCTGCTATGGTGCTGAGCGGCGTGGTGTGCTGGGTGGTCGGCGCGCACGACCA
GTCCTTCCTGGACGTCATGAAGGAGAGCCACGGAGGCGAGTACGACGACGAGCTCGTGGACGGCTACAAGAAGCTCGTGAGCACGCTACCGTTCGCCGCC
TACACCATCATCTGGCAGTGCGCGTACGACCAAACGGACGCCAACTTCCAGTCGATCACGCAGCAGTGCGACCTGCGGCTGACCGCAGCGACCCGGACAG
CTCGCAGATCCCCGGCGCCATGCTCGGCGTCTTCGACCCGATCTTCATCGTCATCTGCATCCCCATCCTGGACTCGGTCGTGTACCCCATGTACGAGAAG
CGGTTCGGCAAGGCTCCGAGCCACTTCGGCCGAGTCTGCGCGGGGCTCATCGTGGCGGCCGTCGGCATCTTCTGGTCGGGCATCTTCGAGTCCATCCGCC
GCAACGCTGGAGCGCTGCAGGACGCCAACGGAGACCCGATCCTGGACGGGGGCAGTAGCCAGCCCATGAACGACATCACGTGGGCTGCGGCCATCCCCAA
CTACGTCTTCATCGCCATGGCCGAGTGCCTCATCAACGTCACGGCCTACGACGTCTTCTATCGGTCGTGCCGCTCACGCTCAAGAGCACGTCGCAGAGCG
TCAACCTCTTCATGACGTCCGTGGGCAGCGTCATGACGTCGTCTTCACCGTCATGTTCTCGCCCTACCTCCCGTCGGACGACCTCAACGACGGCCATCTC
GAGTACATGTTTTACGCGGTGGGCGCCGTCAGCGTCGTCAACTTCTTCGCCTTCTACTTCACGATGAAGAAGATGAACTTCGGCATGTCC