Description :
From Genome Similarity Track
Location :
Scaffold_36:674745- 683282
Transcript NameFunction/comments
Phyin_T30-4PITG_14658Putative uncharacterized protein

Sequence
8537 bases(100 bases per row)
CTGGCGGCTCAAACGTCAGCTGAGCTCGTTAAAGTGGATACTTTGGCCCACGGTGCTGCAAGACTTCAGTGCTCTCCACTCGCCATTGTCAATTTCACCG
GCTAGTGCCCAAGCCTTCTACACAACTACATCCCAGTGCTGCGGATCTTCCGCGACAAGTCCTGCTAACCCACCCCGCCATCACTTACGTCGCAATTGAT
CCTCAATACTATTTGGTACGGTTGGCACTTTATTCCCTGCAATTTTTAGTCTCATCAAATGGGGAGCTAGCTAGCATAGCTGATTCGGTACTGCATCCAC
AGAGATGATGCCTATAAAAATCTGGAGGACCTTTTTGTCAAACCTGGTATCTCGCGCAATTTGTCATTCACCAAGGTGCCGCGAATCACACACCCGACTG
ATTTCCTATCGATGTGCTCCCAGTCTATAGATCGGTAACCCGTTGCGGTTGAAGAATTTCAAGTTGATGTGTGCCTTGCGGACGAGTTGTCCGTGGCGAT
GGTTGTGTGTGCTGCTGTCCGCGTAGTTAATGCAACAGCGACTGGCGACCATCGATCACTACTAGAGTGGCCTACTACGTCTAGATAGCCTTGACAAATG
GACGAGACGTCGCGGATTGCCTAATGGACCCCAACCTGAGGCGTCTGCAATTGAACTCGGTGGCGAGAATGATGTCACGCAAGCCGCAGGGCGAGGCAGT
AAGGCTCAACAGTTTCTTCTGGAGATGAAGGCTTAGGGAGCCTCGGTGGATGCAGACAGCATCTTCAAACAACATGATGGTTCCCAATGGAGCTGGGTAT
CAGGCTTGATCGCAGCCAGCGACGACTAACAACAAGTGGTGGTACTGGTAGCCAAGGCTGGAACCCGACAAGTGACCTCTCCAGCGGAATGGGTGGTCAA
GGCTGGACACCGTCGAGCTTTGACCATGACCAGGAGAATGGCTCTCCAGGGATGGCACGATTGCAATCGAGAGCTCAATTTTGGCATCTGCAGCCGTTCT
GAGCCGAGCGAGATGACATTAGCGTCTTCAAATATCTTGGCAGTGGCGACCTCCCTGGGCAGGGTATGATATTTCTTGGTGGGACTTAATACCTAACTTC
TACTGGACTACTAAGACAACTAGAACTTCTATGGATTAGCCGAAGATCAACAACTACTATTACTGTATCTGATTAAATTAAATATAATTAAATTAGCCCT
TGACCAACTAGTACTATCTTACTAGCTGATTATTATCTGAAAATCGACCGATTTGTGCTTTTGGCCAACGCGTTCGAAGACGAAATTTGTCATGAGTGTT
TTTGACGATAAGTGAAGCTCACCGTGAGTCAGTGACTCAGAGTCACACCGGTGCTAGTAGTCACACGCAGGAACGGCTCGTCGCACAGGACCGCTTCGTT
AGCAAGCACGGGTCATTTTCGTCTGCCCCAACGATTGCTCATTCTGTCTTTTACCAGGAATCCAAGATCCTCATCTTCTTGTCGTGTGGAGAGAGACCCC
TGTATGCCGTGGAGCTCACCGCACACTCAGCACTTGGAGGTGTCATCGAGTTTTTGCGGCTCTACCAGTGGAAGCTGATGACTTTTCTTCTCGGTTGGTC
TGAATTGGCCGCTTCCCAGATTTTAGACCTTGACGCGGATGATTTAGATAGTCGACAATATTACAAGTCTTTATAAACAATACTTTCACAAAAGAAGTGC
TTCGTTTCGTCTCGCTAGTTACTTGAGTGCATGTAGTAGTTTTGTAGGCGGTGATACTGTTCTAATACAGTCGTGGATACCTTGTCCTTGCGTCTCCGAC
TCCACTTCCTGTCTGCGCATCGCCGGTGGCTCCGGCTGCTAAACGTCACTTGACGAGGGACACGCTCATATTGGTAGGACTCGAGTTCTAAAGCAATACA
ATCTTCACACACCTTTAGGTATTAATACCGCCCTTGGGTACTGTAATGTCCAAAGCGTATTATCTCTGTCTCGGACAGCATCTATCTACTGACGAACCTT
TCCTCCTTACGCCCCACCACACACCCCACGCCATACACGTCTGTCTAGTAGACGCTTTCCGGAAGAAGAAAGCGCTTCCCGATCTTGCGGTTGTACTCCA
ACACTTGGGCACGCACCTTCCCTTCTCCATGAGTTTGTAGCGAGAGCTAGCGAGAAGCACCGCGTTCGGGTTCTCCGAAATGAGATCCGTAAAGACGCCG
TACTTCTCCGTCAGAGCGCGGATCTTCTTCAGATGCTTCTCCTGCAGCTGCAGCCCCAGCGCGTCTGCGTCTTCCAGAGTCGTGAGCGCGCGACGCAGCA
AGCGTTTCCTGGCGTAATGGTCCACCAGCAAACCGAATGTCACCTCGTCCGCCTCCACATCTCCGCTCTCGATCTCCGAACGCACACGCTCCAGCAACTG
CTCCGCTTGAGTCGTCCGCTTCGCGCGCACGTACATCTGCATCATACTACGGTACGTGAACTTGTTGGGCCTGAGCTCGAACTTGGAGAACGTCTCGTCC
ATAAAGACTTCGGGCCGAGCGAAGACGCAGTGCATTTCGTGTACACGCCTAGCATCGAGTTCAACGTCGTCCGAGACGGCTTGAGACCCTTCTCGAAGGT
CATTTCATGGAACCGGAACCTTCCGCACGCTTGATGTTGAGCGTCTGGAACTGGCCGAAATCTGTCAAGTCCATCGGCGTCAGCTCAAAGTCCAGCGATT
CCTCACTGTCAGCAAACAGCTTGTCGTCCTCTTGGCCATAGACTTCCATACTCCGCTCCGTCTTGACCAGTGCCGTCGACTCGGCCTTGTTCACTTCTTC
GTGACTGGACTCATCCTGCTGACGCAACGCTTCCACTTGTGCCAATGCCTCTGGACTGAGCTTGTAGCTGTCCCTTTCGTCCATTTCGTCCTCGTCCTCG
CCCTCCTCGTCAAAGCGTCCATCGTAGTTGGCATTCTCCAGCGAGAACGTCTCCTTTCCTGGACGTGTCAAGTCGATTTCCTTCCCGTCGTCGTCCCATT
CCAGTGGCTCCTGGTAAATGGGTTCAGCTTTGGGCAATGGCTTCTGATTCCGCGGAGCCTTGTCCACAATAGCGCGAAACTGAGCGCGTGCGTACACGTT
AAACAGCGTGTTATACACGAACTCGGTCATGGGTACATGATGCCGTTCCATGTGTCGAATGATCTGCTCGGCTTGGATAAAGTCTCCATGCTTGGCACAC
GCGTGCAGTACCGTCGTGTACGAGTACAGATCGGGCGTGTAGTCGTACAGTTCCTGCATCTCGTTGTAGAGCTCGACAGCCTTGTGTGCGTAATAGTGCG
ACTTGGCACACGCATTGATTAACGTGTTGTACGTCACGAGCGACGGGGTCAAGCCGCACTCGAGAAGATCTTCGAGCAAGTTCAACGCGCGCTCGACACG
TCCTTCGCGTGCACAGCCATGGATACAGCAGGTGTACGCCACCTCATCCGGCTCCGCTACGTGCGTCCGCATCAAGTGGAACGTCTCAAATGCCTTGTCG
ATGTCTCCTTCGGCGATTGCAGCGTTCATTAAGATCGTAAATGACGCGCGGTCGGGCACTAGTCCGGCCACCTGCATCTTCTCCATGACGTTGTAGGCCC
ACGGCACACGCCCCGCCTTGGAGCACGCGCGCATCACAGCGTTATACACAGCCACACTGGGATTCACGCCGCGTTCCCTCATGCGGCCAATCACACGCAC
CGCATGCGCTGCCTGTCCGTTCTCACCCAGCGCAGTGGCATACAGCATATACGACTTGGCGTTCGGTGGCACTACGTGCGGTACGCTCTCCAGCGCGTCC
ATTAGCTCCAGCTCCGTGCTGTCTGTGGGCTTGACGGCTACTACAGTGTTCTCCGCCGCGATGGGCTCCAAGTTCTTCTCCATCCGGGTCAACAAGGCAT
TGGCTTCCTTGTGTAGGCCTTTGACCGCATACACTCTGAGCAGGAAATTGTAGTCGTTCACTCCAAGTTCGTGTTGCACTTGCCCATCCCCTTCAACTTC
AACAGTGTCGCCAGTAACGGCTCGTTGTGTCTCATCGACTTCTTTCATGATGTCGGGGTCGGCGCGGGCAATGGAGTTAAGCTTGTTAAGCGCATCTAGG
TGGTCGACGTCCTCGAGACTCGGCTCCGGCTCATACGTGTAGTCGCCCATTGGGCCTGACGTGTTCAGGTACTCGAAAACGTCGTCCAGCTCGCGGTTGA
GCTCGTCGTTGCGCTCTAGTGCCGCCCACTCCTTGGCGTTGCGCTCGTTGATGCGCTGTGCACTCTTGAGGTCACGCATGCGCTCGAGGTGCGTGCGGTG
AGGTGCTGTGTCCTTCTTGAGCTTCTGTTTGGTGTTAAGCGCGTTATGGCTCTTGTTGCCTTTGCTGCGGTTCCAGCTCGAGGTTTTGACGACAAAAGCT
GACGCGCCGCCCTTGCGCTTCTGTAGAACGCGGCTCTGCGATATCTCGCGGTACTGGAGAGTCAATGGGTGCGCGGAAATAACAGCATTGAGGTGCGACG
CAGTAGCGGGCGCCAGCGACGCGCTGAGAGGTCGGCGGGCCGCGACGCGAAGCAATGCGGACATCATGGCAACCGAGCGAAAGTGATTGTAGTGTTTGGC
GGAGAGCGATTGGCTGCAGACACCGAGCGGTTGCGAAGGTACATCAACTGGGACAGAATGTGATGAGCAAGTACTATACCACATCGCTTAAGTACGGTAA
ACTTCAACTTGGTTTTACCAAATGTATGTTGACATATCTGTGGGGGATACATAGTATAGCAGCTAGCTTATACTGGTCGGTTTTTGCGCACCTTTATGCT
AAGCACTCTTGCCCGAGCTAGGATCCACGAGCCTAATCCTGCAGCGCTGTGCCAGGCGAATTTAGTGCATTTTGATTGGTTTCGCTTTAATAGATGGTCG
ACCTAGACATGTCCACTCTAAATCTCAATACAAAATGAAGATGGACAACCTGTTCAATAGGTTGAAATGAATTATTTTCCCAGGCCAAAGCAACACCTCT
ATTAGTTGATTGTTGCTTAGAAGAAATTAAAAGTCGCATTTTGGGGTCTGAAGTGAAAGCAATTAAAAGAATAGTTGATTGTTGCTAAGAAGAAATTAAA
AGTCGCATTTTGGGGTCTGAAGTGAAAGCAATTAAAAGAATATTCAGCTGTTATTCACGACGGCGAAAGTGGTGGCTTCTTCAAGATATCCCCGATTAGG
AACGAGAATTCGAACAGTTTCCACTACGAACTTTCTCGTAACGAAGAGCTGTTCCAAGGTTGCGACTTGCACTGCCATGTAAAATGACGAGCGTTGTGGC
ATTTTCCTTGTTGACAAGAAGGACCGATTTTTTTTTTCCGAACCGTGACCCTGACACTTTTCTGATGTGAGAACGAATGCAGGGGAGTAAGAAACTTGAA
TGTTAAAGGACCGCTAATGCCGATGCCAAGGACTCAATAACCAACCTAGTTGATCTTGTAACTCGCTCAGTCGAAAGCCAAAATGCAACAGAATCACCGT
GAGCTTCAGATGCAAAATTCTAATTTGTTTGTTCAATGTCGCTCCAATGGATAAGAGTGAGCACAGGCGACATCCGCCGAGCTGATCAGATTTCATGCTT
TATTGGTTTTTACAGCTAATTGCAAGTTGTTGATTTACAGTCTACGACTTGAAGATGTGTTATGAGAGGATTCCCGCCAAACACCCAGAATTTAGTGAAA
AGCCTCACGATATTCGAGGTGTACTAGATTTCGAGGTCATGTCGCAGTGCGTTTAGCTTTCTGCTATTTCTACATTTTTAACCCCTCTGTTACCAAGTCG
TATCTTACGACTTCACAAAACTACAAAGTCGTAAGATACGACTTTAGCAACGCCAACAATAGCAAATGGCTCGATGAAAATGTTCCATTACTTTAATCAA
GTGTAATTTCTGCTCCAAAAGGTATAAGGTCACACAGGTCAAACTTGCATGTGCACAAAACGGGCGGTGGAAAGGGTTATGCGGGAAATGCTGATCCGTA
CCCAGTGATGAGTGGCTCCACGGTTCCAGACGTGCTCATTTGGAAATTGGAGCTCTGTCACGCAAGTGGATAGATGGCGAGGTTGCGAACGAGTACGGTG
ACAAAAGATGCTGCGGTGGCGCGTTCGGTAGACTTCAGGCATCTTTGGCGGCAGCTCCGCGCGGTCGGGTGGACGTCGAAAAGACCGACGCGGCTTGCTA
CGGAGTGGATGTACTTCGCTCCAAATCGTGACTCGCAGGAGCTGGTTGAAGGGACAAACATGTTCACTGGTAAGCAAATCTTTGGAAGGGTTTTATATCT
AAGTACTAACTGTTAACATGCTCAAAGGCGAGGACGCGGTTGTTAGATATGCCATTTCGTCTGGGCTGATCAATATGGACGAAAGCAGTGACGACAACGG
ACAGGAGTCAGATGAAAACGTCCGTCCTTCTCAAATTGACTGCTCTCTGATGTTGTCCGCGCCTACGCTGGATGCCCTGTTTGACGGCAGCAGTGATGCT
AACGAGGAGAATGCCGGGCCTGATACAGGAGTGGCTGCACCGGCTGCGGACATAGCGCAACAGTTACCTGGTCAGATCGGGTTATCAGACGAAGATGTCG
TTGTTGGTGCGTTCCAGCGAATGCTGTCGGAAGCTGAATCAGAAGGACATGTCCAGTTCTCGGACAACGAGAGCAAGCAGGATGATGTGGAACGTGTGGA
TACGTCTCCACCCGCTGTCCACGTTAGAGCGGACGATGTGAATGTACTACAAGAAGACGAACACTCCGATGACTTCGAGTGTATGGAATCTAGCACCAGC
GATGATGGTGGTGATGACTGTGAAGAGGACGATGTGGTAGAGCGCAGAGAACATGTTGAAGAAGACGACGACGAACTTCCGGATGATGAGCTGAAACTAG
TTGACGAGGCATTTGTAGCTTCTCTTGGTGGGACTCTCTCCATTGCCAACATCGACAAGGATGCTTTGCGCCTGACGAAGTGGAGTGAACCGTCCTCTCT
GTTCGAAAGTGGTAGACCGAGCTACCAGGGGCTTTCAAGTGACGAAGCAACTCCTACGCACGAGCTACGGGAAATGGCAACTACACCACTAGGGTTGCTG
TTCTACTTCATGCCTAAGCAGTTGTGGGTCGACATCGCGACTGAAACCAACCGCTATCGAGCCCAGAACATTGACTCAGAAGCCAAGAAAATACGCTCAA
GCCAGAGGCGTAACAACCGTATCGCGTCACCAGAAACACTTTTGCAGATACGACGGCGTTTGAGGGCTGCGAAGGCGTACGATACCTGCGAAATCTTGCA
CGTGATCGGGCTGCTTGTTGCGCACATGTTGTGCCCCCACAAGCAACGGTTTTCGAAGCACTGGGCGATGGCGTGTGACGGAGCTTTACCTGCTGGTACC
TTTGGCAAATATATGCCACGCAACCGATGTACAGCTATCCTACGTGATCTACACTTCACAAACAACAATGCACCCCGCACTCGAGACAAACTGTGGAAAC
TGCGTCCGGTCGTCGATATCCTGCAGCAGCGCTTCCAATCTGGCTGGACATTGCCGGCAGTGTTTTCGTTCGATGAAGGTGTGTTACCAGCAACGTCTCG
GCGGAACACTACGCGGATGTTTATGTCAGATAAACCTCATCGGTACGGTACCAAACTTTTTATGGTTTGCGACTCAAAGACAGCTTACTGCCACAGGTGC
GTTAGTATCCTTTTTTCAAAGTCGTAACTTCTGACATCTCTAGCAATTCTGAAAAGCTAACGTCGTAACTTACTGGTTTAGGTTGGAGGTCTATGTTGGA
GCCCGTGAATCAACAGACGGAGAATCCACAACTATCGACAACAAGACGGGTGCGGCTGCCGTCATTCGCAACATGAAAATTTTACTTGGCGACTGCTCTA
GTGGATTTCTAATGGTCGTTGTCGATCGGTATTATTCGTCCGTAGCGCTGGCTTTACAGCTCCTCGGTATGTCTATCTACGTCGTCGGAACTATCATGAC
GAATCGCATTGGATTTGACCGTCAAGTCGTTGAAGGCCGTCGGACGCGGCCTCGTGGAGTTGAGAGAGGAACCTTTACGTTCTCGCGCTGCGAGGCAGCA
CCTACAATGGTTGCGTGCCACTGGTGGGATAGAAAGCCAGTCCATTATTTGGCCACGGGTGCATCGATGGAGGAGGATACGATTCAGCGCAATGTGAAAC
AAATTGGGGCGATTACTGTGAAGTGTCCCAAGCTAGTGACCGATTATCAGCGGTGGATGGGCGGAGTTGATATTCATGATCAACTCCGCCTGCAGTCGTT
CTCAATTCAAATGGCTTATCGGTTTTGAAAGTACTACAAGTCCTTATTTTTAGGCTTCCTAGATCTGGCGATCGTGAATGCTTTTATCACACACAAGGAG
GTATGCAGGGCCGCGAGAATTGCGCCAATGTCTCGTGCTGCGTGGATGGCTGTCCTCCACAACCAGCTCCTGCAATTAAAACCCGAAGATTTCGACTTGG
ATCCTATAGCAACTCCACCGTCATCCGCTCTCTCCAG