Description :
From Genome Similarity Track
Location :
Scaffold_456:6745- 8364
Transcript NameFunction/comments
Phyke_g9648hypothetical protein PHYSODRAFT_339981

Sequence
1619 bases(100 bases per row)
actcactttccaatttgcGCTCCGCTACTGACACGACCTTCCAACCCAAGCACCCGAGTCATCAAACCTCCGGAAAGACAAGATGCCTCCCTCCCCGAAC
GTCAACCACGAAACGGGATACGCGATCGCGCTGTCACCAGCCACCGACCATGTTCGTGAACCGGCCCTGAACATCGAGCAACGGGCCATTGGCGCACGGT
GGATTGTCTACACGTCGGTCGGCATTTCTATGCTGGAGGCCTTCCACTACGGTTGGTCGAGTCACCAGATCAACCTGCACAAGTTCCACAACGTGGAGGA
CTGTGCTGCTCGCCCTATCGCAGAAGACACGTGCATCATGTTCCCCGGCCACACCAagacgacgtggacgctACTGACGAACGCTTGGCTCGTCGGGGGC
ATGGTCGGAAGTTTCATGTCGAGTTATCCATCGAACAAGTACGGGCGCCGTATGACGCTGCGTATGAACACCATCATCATGGTCTTGGCGTCGGTCATTC
AGGTGCTCGCCCCCACTGCAGCGTGGTTTGGAATCGGTCGGTTCGTCGCTGGTATCGCCAACGGTGTCGCCATGGCTGTTGTAAACACGTTCCTGAGTGA
GATCTCGACGCCCCACAACCGCCACGCCCTCGGCACCAACACGCACTTGGCGGCGACACTCGGTATCTTAGGCGTTGCCACGACGTTCTGGTACTGGAAT
ACGACGTCAGGTTTCCGCTGGATCGCCGGGATTCCGATTGTGCTTGCCGCCGGATATCTCGTCACGTCCTACTTCTTTATGGTTGAGAGCCCGGTGTGGC
TCGTGGCGCGCGGccgagatgatgaagccgAAAAGGAAATCGCTCGTCTCTACGGCAAGGAGAATGTCGATGCTATTATGAGCTGGATTCAAGCGCGCGA
CAGCCGTAGCAAACTACCTTCCATGGtcagcgatggagaaatgGTCCAAGTGGAATCTGAGAGCCCGTGGACCATCCTGTTCAACCCCAAGTTccgcaag
cagctcggcGTGGCGCTCGGACTCACCTGCATCAATCAGCTTGTGGGCATCAATGCCGTGTTCTGGTACTCGTCCTCCATTTTGACAAACGCTGGTATTG
CGGATGCTCGTCTTGGTGTAGTCATCATCGACATTCTCAACGTCGTGCCGGTGCCCATCGCCGCGTACGCTACTCAGTTCCTGCCGAAGCGCGCTATGCT
ACTTTGGGGCATATTTATAATGgcgctctgctgcattgggATGACGCTCTCCATGGTCTACGGTGTCGGCTGGCTGTCCGTCACGATGCTCGGCATGTAC
GTGGTCGGCTACGACGTGAGTATCGGTCCACTGCTCTGGCCGATGATCGCTGAGTTATTCCCGGACTCGGCGCGTGGCGCCGCTGTGGGTATCTGTGTGT
TTTTGAAGTGGGTGTGTGCGCTGATCATCGGCATCGCCTTTCCGTACGTCCAAGAAGCCATCACCGACTACAGTTTCATGCCGTTCCTGGGCACGACATT
GATGTCCATCGTATTCATCTACTTCATGGTGCCCGAGACATCGGACTTGACTATCGCCGAGATCCAGAACGGTTTCCGCGGCGATCAGAACCTGCAATCG
GTTAAGAGTCAGCAGTAGG