Description :
From Genome Similarity Track
Location :
Scaffold_1523:6744- 8102
Sequence
1358 bases(100 bases per row)
ATCCGTTGAGAGCGATATACCAGAAAGTACAGGGCTCGCGAAAGAAAGTCTCGCAGAGGAGCTGGAGCTGCTACTTGATGAAAGACGCGAGCTGATTCAG
AGACTTAGAAAATTGAATTGAAATGAATTACCATGATGTTTAGCTCCTTGGTGGTCGAACTAAGTTGTTGTTTGCCACAGCTTGAACAACTCATTCACGT
ACAGCTTCATCCATCAGCCGCACCCTGGTGCCGCACTCTGTTTCAAACACAGTCTCGTCGTACGAGATGTAGTTGTCTTCGTTCCACGTGCGGACGTCTT
GCAGCATGGAGATGGTGGAGACTGAGTTCGATTCCAAACGCCGCTGATCTATGCAAAAGTTGTGCAGGCGCATACACGACACTATCACGGCGCNNNNNNN
NNNNNNNNGAATTCGCCACTTGTTCACCAATAATCCGAACGCCATTTCCACTCGTACTCGTAGCTGGCTGGTGTAGAAATTGTAGTTGTCGCGGCCTGAG
TTGCGGACCAGCTGAGCTTTGTTGAAAGGCGTCATCACGAACTGACTTTGCAAGTAGGCGTTGTCGCCGACGGTGTAGTACGGCCCCTTGATCTCCAGCA
GCATTTTGCTCAGCGCCCATCTCTGGAACGCGAGCGCGTCGTTCATGCTGCCCGGCGAGCTCACCGAGAATGCCACGAAACGAGAGTGATGGTCAGCACA
CGCCTGCACGTTGAGGCTGTATCTCTGGTAGTGCCCCGAAAAAAATGGCGTCACGCGACCGCATTCTCCACTGCGAGGAACTCGGATTGGGCAGAGCCAG
TCGTCGACAGCTCCAATGCAGCCACCGATCACTCCACTCGTACTCTTGCCGCAAAATCCTTCTGCAGCTTGTTGTTGCTGGCGACGCGTCAATGGGAATT
GCGGCGCCAATTCTAGAGAACTATTAATAGCAAATACAACTGCATGAGCTATTCTACAGAATCCAGACTTACTCGTTCCTGTAATAACTCGAACGTGGTG
ATGACTTCCTCCTGCGAGCTAACTCAGATAGCACTGAAGTATTCCTGGTGGAGAGACGGGCTCACAGCCAAGTGCTCAGCGGGCTGATTGAAGGCAACTG
ATCACCAGCTTGGGGCGACAATTTGTAACAAGCTCTCGAACGACAAGTAGCTCGTTCGATAGTACTTATTGAATGCGGGCTCTTGTAGCAGTCGATCAGC
GTGTACGTTCCACTGAATTCGCTCTCGGACAACTGCGCCGCACTGCTCCTCGTCGTTGTGCGTCTGGTACGCGATTGCGCACATCACAGGCATCAAGATG
CAGGAAATTTCATCAACAAGACGCTGGCGGAGGTGGCGCGTTGCCTGATATTGGCTCG