Description :
From Genome Similarity Track
Location :
Scaffold_3:674397- 678156
Transcript NameFunction/comments
Phypa_INRA-310PPTG_01381hypothetical protein

Sequence
3759 bases(100 bases per row)
ATGAAGAGTTACTTGCAGCGATTATCCAAGACTACGTGAACGCACTTCACAAGGGCTGCACTCTAGTGGAAGTTGTTGAGACTGTGGGTGATCTTACAGT
AAGGCTGCTGGAGTTCACTGGCGATCTCACCGTGTTACGCCAAGTTATCCAGAATCTCACACGTCTACTGCATTTACTCGTTCTTGACCCGAGTGGCGGA
CTACGAGCGCCAAGGTCTCCTGGCAATAACAGCGGATTGGGCTCTGGAGCTGCTGATTATCACTCGTTGTCAACAGTAGATCGTGAGCTGTTGATAGCTG
CGATTCACGCTCAACGAGGACGACTGTATGTACTGTCAAATGACAAAGTTAGTGCACTGGAAGACTTTGATCACGCCGTGGTGATGGAGTATCACTATCC
CGTGGCTCATTTCTATCGAGGTGCCTTTGCGACTCTGTTATTAGCGAAAGATTCTGCTGCTGGAATCAATAAAGACACAGAGACCGCCGCTGCACACCAT
GCCAACAACATGCAGCATCTCTCTCGATGTCTTGCATTAGACCCAACTATTGGAGGAGCATACACTGTGCGTGGAGCTTTACATCTGCGGGATCTGCGCT
TCAACAACGCTCTGCAAGACTTCAAGGCTGCAGTGACCACAGATCCGACGTTGTCCGAAGTCTGGCTGCAAATTGCCTTGGTGTATCTGAACCACTACCA
CGACAGTGAAGAGTGCATTAAGGCTTGCACTAGTGCATTGGCTAATGATGCTGGACTATCTCGGGCCATTTATCTGCGTGCTGAAGCGTACACTCGTCAG
GGAAACACTGCCGCAGCTCTCCGAGACTACACGCGGCTAACCCGAGCACATCCTAGCGATCGCTGGGCGCACCTATTACGTGGAAGACTCCAGTTGACGC
TTAAAATGGCCCGACCAGCGCTGTACAGCTTCGTCTGCTTCGTAGAACAAGTCACCAATGATCTACCGACTTCAGTCGATACTAAAACCAACAAAGACAG
CAAGCCTAAGAAGGATGCTCTGTTGTTATGTGGACGAGCCTTCCAGCTCTTGTCACGTTTCCAAAGTGCAGTACGTGCTTTCGAACTGGCAGTGGCAGAG
AACCCAACGAGTGAGAACCTTGTGCTGTTATCAGAGTCGCTGCATTCACTGGGTGACACTGAAAATTCGTTGCGTGTGAGTGAGAAGGTTGTGAATACCG
ACCCGTCTAGCTTCAGGGGATACGCTCGACGCGCTCAATTACTCGTGTCCGTCGGTCAATTCACTCGTGCAATGGCTGAATATGACAAAGCGATCTCACT
AGCGCCCAAAGAAGGACGTGTGTACTACGAGCGTGGCGTCGTTCAAATGCAGCTGTACATGCGATGGCGAGTGGCCTTCCAGACTAACTTCGCTAGTGAT
ACCGACGCAGCGCAGAGAGTGTCTCGATCGCCATTCGCACCGCGTATTTCTATGCGAGAAGTTGAAAGAGATTTGGGTGTTAATGCTGTAAAAGATGAAA
CTTTGGTGCACAAAATGATGAAGCAGTTCTTCGTGGGCAGTATCGCGGATTTGTCCAAGTGCATTCGGCTAGAGCCTCTCATCGCAGACGCGTATGTGGA
TCGAGCAGAGCTGAACGCACTAGGGGAGGAATATGATCGCGCTTTTCGTGACTTGGAGACTGCAACGGAGCGTCAACCGAAATATGCTCGGGCTCATGTG
AGTCTGGGTGTGCTGAAATGTCAATTCTCTGCATACGCCGCTGCTATCGAAGACTTTGACAAAGCTATCAAGCTGGAGACTACAGCCACCGCAGAGATGC
GTGGCTATGCGCTTTTCAACCGCGGTGCGGCGTATCAAAAACTTGAGCTTTGGGCTCAAGCGGAAAAATCATATAACCAAAGTATCATGTTGTTTGGACG
AGGTCGCGATGTTGCAGCACACCGCAACCGCGCGATTGTTCGTTGCCACTTGGGGTCTTTCAAAAGTGCGTTGGAGGACCTGGAAGAGGTTCAACAGAGC
GCTCCAGATGACGATGAACTCCATGGAGCTTTGGGCTTTGCGTTGCTACAACTCAATCGCTACGAAGATGCTGCAAAGCATTTTGCCGCATATGGACGGC
TTGGTCGTGATACTTACGTCGACGGCGGGAATGCGTACTTTAACTTGGCTACAAAGAGTGGGACGCATCTCCAGCAAACACAACACGCAACTTATCTTGA
ACGAGCTCGAAGGTTTTACCTACGTGCTGTGCGATTGCAACCATCAAATGTTGATATTCGTCTCAACCTGGCGAGTTGTTTGAGAAAGGAGAACGCCATG
GGTGCGGCGATCAGACAGTGTGATATCATTTCACGCGAACAGCCACTTAATCATGCCTGCTTGGAGAGCAAAGCGCTTGCTCTTTTCCAACTTCCACGTC
GACAGAATGAAGCGATAACATGTATGGATGCTGCCGTTCGAACGTGCGTGTCTTCGTCTGCCAATCTGGAGAATAGTTTCTACGCGTTTACAAGTGGCAT
CATTCATCGCAACTCCCTTGACCGAAAAACTGTTCACCGTAAAGGAACTCGTCGGCTCTCTACGGACACGGAAGGTCTGAATGAAGATGGTGGATCTATG
AGTGCTGCTGCCACGCTGTTGGCGCAGATGGAGACACCAGCTCCCAAGGTTCGTCTCACTGGATCAAATGAGCAAATGCTCGTGTTGTATATGTTGAATC
GAGGTGTAATGCTGGAGAAAATGGGGAATTTAACTCGAGCTCGCCAAGATTACGAGGATTCGCTTCACTTCGACCCGATGTCGGTACACGCTCACGTGTG
TTTGGGAACACTCAGTCTCCGGGAACGTAATTTTGAGCAAAGCGCGGTTGAGTTGCAACATGCTCTTGAACTTGACCCGTCGTCAGGTGTGGCACATCTC
AATCTCGGCGTGGTTTGCTTAAGTCTCAGCGATGTGGCTAACGCTCTCGTTCATTTTGACACGGCAATTTCACTTTTGCCACACTGCAGCTACGCGTATG
CAAATAAAGCGGTGGCACTTGCTCGCAGTGGCGACATGGCTGGCGCGGAGCTGCACTTCAAAAAAGCAATAAACGAATTGCCATCACGAAAAGAATTTTA
TCTGGCACGTGGCAAAATTGTTGCTTTACAGAAGCGATTGCACGACGCAATGGTCGATTTCTCGACCGCGTTATTTCTCGGATACGACGGCAAACTGTAG
TAAATATTATCTCGAAGTTTTTGTCAATATTTTGAAGTGCTTTCAACATGTACAGCGTGAATCGGTGTGGGCTTGCATATATCAGATCCACACTCAGTAT
TTTCAACTGTCGTGGCACCACAACACGAGTTTTCAGGAACAAATTTCTCATCTGGAGAGGGCGAACGCAGTTGCCACTGGTCTTCACTAAAGCTGCGATC
GAAGCAAGCAAGGGTCGGATCAATGGGCAACACTGACGCGCTAACTTTGTCTTCCAGCTTCTCACTATCACAATCTTCCGAGTATCCACAATTTGTCAAA
AACTTGGCAGCCTTTGAGTTTTCTCTTAGTGGCGAAGATTCCGAGCTTTCGTCCTCGGTTTCGGTATCCTCCTCATTGAGTTTCCAGTTGCGACATCGGA
CGATACCTACACCAAATCTCGCGCGGTTCACCCCAACAGCTCGTCGGCGACTCAGCGGAGGACGTGGAACAGTGCGTCGAGGTATTGTGGGGCGTGGAGT
CAAGGCTCCGGCTTCGACGTCCTCTTCCAGTTCTGAGGCTTCTTCATCTTTNNNNNNNN