Description :
From Genome Similarity Track
Location :
Scaffold_1492:6743- 9171
Transcript NameFunction/comments
Phypl_g13548hypothetical protein

Sequence
2428 bases(100 bases per row)
gacgacgtAGGACTCATCCACGAAGGATCGGACCTCTTCGCAGAAGAACTTGAAGCGGAGATGGCGGTGTTGCCGGAGATCTCGCTGACGGCAGAAGTGC
GGATCGGGGATCTGAAAGTGGGAAGGCCGACCGGGGACACATCCGAGGAAGGcgcacagcaagaagagctccTACGACAGGTTATCTGGAGGCGATGAAA
ATGGCTTATCGGGAAGGGCAACGCTTTACCGCCCGCGGCCGTGGGAGTCGTCTGCGATATCGATGTGGGCGACGCGAAACCTGTAGCGCAACGCGTCCGC
AAGATCCCGCCCCGTTTCAAAGAAAAGGTGTCCGACTTGCTCAAGGGCTTGCTCAGTGCTGGCATGATCAGActgtccacgtcgccgtggGCGTCACCGA
TTGTCGTGATCGTAAAGAAGAACGGGGTCGACATACGACTCTGCATCGATTACTGACTGGTGAACAGACTGACGCAGCTGATGTTTTACCAGATGCCGCT
CGTGaacgacttgctggaggaTCTGGACAAGTACCTGTGGTACTGCTCTCTAGACATGGCCAGCGGATTCTGGGTCGTCCCCATGACGGCTCGAGCCCAG
CTCATTTCCGCGTTAATTACCCCGTTCGGCCTTTTTAAGTGGCTGCGCATGCCATTTGGCCTGTGCAACGCGCCACAGATCTATCAAAGACTGATTGACA
ACGCGCTCTACGGATTCATGAGTCTGCCGCCCGGCCGCGATACTCGGAACGTCTTCGATGAGGGAGAACCAGAACCCCCAGGGATCCACTCCGTCCTAGG
TCGGAGATCgtacatcgacgacatcctaATCGGCGGTACGTCGTGGGAGATTTGTGCACGAAGGtcgagcggctgctggacgtcTGCGAACAATGGCATC
TGTCCATCAGTGTGGAGAAGAGTGAGTGGGGATGTCTATCTGGGCCACAAGGTCTCTGAAGCCGGAATTGAAGCGAAACCGAAGAATCTGGAATCGCTCG
CGGCGTTAGAGTTCCCGCGCACGCTCAAGGGTCTGCAATCGTTCCTAGGCAGCCTGAACTACTACCACCGGTTCATCGCGGAGTTTGCGGTCTACGCGAC
TGCGCTGTACTCCCTCACGGAGGTTGACTTCGAAGCGTACGCCACCCGACCAGAAGTTCACAGCCAGGAGAAGTGGATACACGCTCTACGTGCAttcgag
acgctgaaggccaagatcaCCAAGACGCCGATGCTGAAGCACTACGATCCAGACCGGGAACCGGTAGTCATCGTGTACGCCAGTGACTGGGCGATCTCCG
CGGTACTCGCGCAGGATCATGACGGTGTGTGCATGCCAGTGAAGTTCATCAGCCGCACACTCAAGCCCAACGAGCTGAACTATGACGTCGCCGAAAAGGA
GACCCTGGCTATGTTGCGCATCTTAAACGATTGCTTTACAATGTTGGCCGGAAGGACGATCCGTGTCCTGACGCGGCATACGACGTTGGCGTGGCTTTTC
CAATCTAAAGGACTGCAAGGCCGACTGTCGCAGTGGGCCGCGATACTCTCACCGTGGAGACTCGAGATATTCTGGTCCATgaaaggagaagaagagatCC
TGGGAACGCTTGCCGCGAGTATCACGCCCAGAGCGTTCGTAGATAcggcgctggaagagatCGCTCCACGTAGACGTTCATCGCGGATCACTGTCATCCC
GATCCCGACGGTGTCAtcggacgaagagctgcatgtCATCAGCTTCAACCGATCGACCAGGGCCAAGCGCGAAGGCGGATCGCTCAGCGCGATTGTCTGG
AAACTACCGGGCTGGGAGATAGTCTAGGCTGCGTCGGGCTACGCGTCCGACCTCACTGTCAACGAGGTGGAGTACCGGGGATTACTTCTGGGGTGTTCGC
TGCTTGAAGGACTAGAGGTCACACGACTGGTCGCCTGTGGAGACTCGAACCTCGTCATCCGACAGATGCGTGAAGAGATGGAATGTAAGTCACCTGGCCT
AAAGTTGTTGCGACAGCGAGGTCGGAACGCGTTACAGGCGTGGCCACGCCATGAACTCTTCCACGTGCGCCGAGCCTGGAACGCGAGTGCGGATATGCtc
gctggacaagcactACAGCGTCAGAGTGGAGTGACTGTTCGCGAAGTCCAAGACCTTAAGACGCTGAATCGCCTGGGAGAAATCATCCGACCGGAACTTG
GAACGCCAGATCGGCCTCCTCAGCCGGAAGATCAGGCTGACGCAGAACGCAGAACGGCGCGGATGTTGCCTGTGGTCACGCGTTCTGCCGCGGCTCGggc
ttcgacgccaagagATCGAGCGCCAGAGGCTCTACAAGAGCTCGTTGTACAGCAACTCCGACTGGACCGCGTCCGCGTCGCGCAAGACGAGGAACTGTGG
ATCGCGAACCTAAAACGATACTTGAGGG