Description :
From Genome Similarity Track
Location :
Scaffold_30:67425- 93878
Transcript NameFunction/comments
Phyca_LT1534534939Hypothetical protein
Phyca_LT1534507758Hypothetical protein
Phyca_LT153434841tRNA (cytosine5)methyltransferase NSUN2 putative
Phyca_LT1534568700Hypothetical protein
Phyca_LT1534116325HECT-domain-containing protein
Phyca_LT1534568701PREDICTED: unconventional myosin-IXb
Phyca_LT1534528429zinc finger (CCCH-type) family protein
Phyca_LT153450776040S ribosomal protein S6 putative
Phyca_LT153479665cytochrome c/c1 heme lyase, putative
Phyca_LT15348649cathepsin c, putative
Phyca_LT153417710myotubularin-like protein
Phyca_LT153435736myotubularin-like protein
Phyca_LT1534116094Hypothetical protein

Sequence
26453 bases(100 bases per row)
tcctccgagctcaccagctcctcgcacagctggttcacaagcggggtctgtccctcgaggtcacttagcagcagcagtttgagcttggtagcgtcgctgc
gcatcgtcatcgctgtggattgacaggtttgcttggttcgatttcacgcaacataagcttctagcaacattagcgatgatgacaaatgggaccgtcgatc
tacaacgcgaagcgacgaaggaaaggtagctcagtgtttgggctatgcccagcgggcgttcatgaatcttgtggcgctcatgccgacgctgacgaaagac
tcacattaagagtggcaccttttcatcttgtggacgaagcatatcgtttttgttggcgtcaagtcgctaggaatggtggtttgtcgccagcgtatacaag
ttgctccgtcgcagcacgcggagccggacaatctactggcaaactattggagagctgtatgttactacactgccctgcgttttccatttctgtcgacgag
tccagcggcatttaacgcggtttaaagtaccaaatgcatcagtggtgcataccgtcgaaacgccagcagattggttcttcccatcgctgacgtcggaaac
taccagaagtctgcgcacatgacatgactaatagtgtcggtaacgttcatctccatttttgcctgaagaaaggatgagcctcgccgttgaagagaaaaac
gttcggacgcagcaccactgtatacaccggataatttctcattccgctgttcgacaatcgtacattatcccggtaaatttacctgattctatacgtacgt
atacgttgtcgaccgttagtgctcgggttgcggcttcgcgccatgggatggggagcgcagaaccgggaaggcgcccccacgctctccattcctcgggatc
cagcaacgctcacttccgcttcactcgtcccgagtcctcttcctcttattgacaggcctcctctggccatgaacgctgctcattacttattggaccgcat
gcgcacgtgcaaggcactgacagacattggcgataagaagtcgcgcggctgtttcgcgtcggtaggcagcgccacgcactctttccacggagatgatgcg
gtgggctttggaccaagttacatggtggtggcggacggtgtgtccggcaccatgaaggcgtcaggtgtactagctcgcatgctggtggctgagacgctga
cgtctcttgcgaaactccgcaaacgttctcgtgaagagcccccgtgcgctgaagactttaaccagagcatgcaggcagcgatcaagagcgcgcgcaagct
ggcgaagcgcaaagggagactcgactcgacgatctcggccgtttacttcgatgagacttctcgacagatgttcgtgtacacgatcggcgactgcaagtgc
gtggtgttccgcggctctgagctcatgttcgaaagcgactcgatcatctacgactttaatgtgcccgcggtggtatccagcaaccagtctattaattatg
cagcagaagtgcagatacagaccttcgagtatgaagcaggtgacgtgtgtctcttgttttctgacggagtacacgacaacttgtacgtggacgacattgc
agcgtgtctcgcctcaacagtaagcgcgtcgtcgtcaaggtccaagggcggagcagcagaagacatggcacgaaggatagtgcaacgctccaaggaaact
tttaccagcactacagaattcattcctttcgccgtttcagccgcgggattctgccgcgaagctctagccgaactagaggcaaacaaaacagtggactcgg
aagagttcgagcggtttcgacagaaatgcgacactattccatctctagacgtgcagcgcgcggccttcgctaaggagcgacgagttcgtcagctcgcttt
ttacagcgcatccaacctgcttgccttcgcacacaagaagcagggtaagcgtgacgacatttccgtgtgcacagcagtactagcgtgaacatgctccatt
ggcaggcatgaaattaacgctcacacatacagacaagataatatcactatgaaattagtaaaacacgatatactagcggcaatcatttccaaccagtgat
tggaaaaatgtattggaaggcattgagaaaaaatcagtactgtgcagtatgtactgcaattatccgggttgggctgccgtaagtactgcaatatcacgtc
gggtcgcaatacgtactgcaataccggtcgagtttgcaataccactgcaatactattgcaataatactctttttcttcatcttggtcacctggaacctct
ttaccgcgatcattgccacaaaccgctgagaaagctggtgggcttcgaacccaaggcagtagtgtgatatggtcgatctcaccccactgccccgtcctga
cccttgcaatcggataagacgaaaaaagagtactttcggacattactggcaattcgtctggcaattcgtcgttttgaaccttcgggggagggtctgggta
agaattctagaaaaaacgagaatctaaaacgtaggattgactgaatatcagtatagcaataccaagcgcggctgcaatacgtattgcaatatcccgcgca
cctgcaatacctattgcaatacctgacagcgtgcgcaatattatattgctcccagtattgcaaaattccaatacctgcaatacattttttcccatcactg
tttccaacggcttttcaagaattattttctgagctccactgtaccattttagcggtactttagctcctcacctgtcatttatccatcagacagcaacatg
ggcaagcgatcgcgcaacggaagaggtggaggtcgcggaggccgtggcaagaagccgcgtgcggatggaaaggaggaggattggcgcgccgacaagttcg
cggattgggtgtacgagaacgagaactttgacgcatactacaaggcgcagaacatcatggaagagtcggactgggtcgcgttcaagaaggcattggccac
gccactgcctacgacgttccgtatcaacagctcgtgtccatttgctgaccggtaagttgtctatggtattgcacaacttttaggagctttacagctcatt
gtttttgtgtgttggtatagcattcgtgaccacattgaacaggattttaagttcgacggcctagtggtggacgacgagcctgtggaacccattagcccca
tgccctggtaccctgacaaccgtggcttcacgtggtcagtggaacgccgtcgtgtgcgtaagctaccgattctgaaggagttccagtcttggctcgtaga
gctctcgaacagtggaagcatcactcgccaggaggctgtgagcatgatcccgccccttgtgctgggtgtggagccgcatcataaggtgttggacatgtgc
gctgctcctggctccaagacgtcgcagcttctcgagtccctccactcgcaggagtttgcaacaggcaagaccccaactggtgtggtagtggccaacgacg
tggaccttaagcgcgcgtacatgctggtgcaccagtccaagcgtatcagttcacctgctttgctcgtgacttgtcacgaagcacagaacatcccgttcct
cggcaaggacggaacggaaagcgaaggagtttttgaccgcattctgtgtgacgctccctgcagtggcgacggaactttgcgtaagaacccattgatctgg
aagacatggagtgccaagaacggtattgcacttcacccgttgcagctgcagattgctaagcgcggtgcggcgctgctgaaggttggcggcaatatgtgct
actcaacgtgcacgttcaaccctctggagaatgaagcggtggtggctgacttgctgcgctggggcaagggctcgctggagcttgtggatgtgtcgaacac
cctgccactgctgaagcgccgtcctggtatcagcacttggaaggtgttgaactcgcagctgaaggagtacacgtcctacgacaattatgttgaggagaac
atgaaggacaagaccaaggataaaattcgtgccacaatgttcccgccgactgagaaggaagctgcggatctccatcttgagcgctgcatgcgctgtctgc
ctcaagacgagaacactggtggatttttcatatgcttgttgaagaaggtggcacccactccggatgataaggaggaagagaccttggacaaggctcagga
tattactgtcaaggccgaaaagactgtcgatgactcagaagaagttgctgttaaggaagaagcagggggtaaggatgaagatgaggttaaggaagaagcg
gctaagaaggaacagaagcctgcttcggaagaggctagtacggaagaggcaaagccacgaagaaaccgccgcgatgatcgccgcaacaagaagggagaag
tctacgtagctttcggtgctgacaactggaccaatgtgcgtgagtattacggtgttgcccctgctttctcagcagagcagttgattacacgctcggagga
tgccaagtctgtcacttttgtgaccgagagcatcacgatggcgctgttggaagagatgaggcgcaagaagctcaaggttgtgtacgctggtctgaagatg
tcgagcggaatgagacgaccgaaggtggtaaggtgtaccgcgtgtgccaagctggtttgacgcacattctgccattcatgaaccagcgtaaggtcaaggt
gtccgcgaaggacttccagatgatgattgagcgccttggtgacttgctggacttcgatgagtttgagccagcgaccaagcagtacttcgaggatgctcca
attggcagtgttgtgtgcatgcttgaccgccctggccagtcaaacgttgagtacgtatctttaggtgtattttatttggtgtacatgcttatctaacatt
gtgttgttgtgaaacaggtcgaaggtgatgaatctggttgtgtggcgtggccgcaactctgtgaatgtgatggctgccaaggcggatgttgctgtgctac
tgggaacgatgaaagagctggggatctacaaccctactgtccaggaggccgtaatgaaagctaagaagctcaaggacgaagaacgtgctgcccgtgacga
taagaaggaggtggagacgaacaatatggaagacgacagcaagacagcggagaatgctgaaactaaaccctccgtctaagactgggaagacttccagcta
acgagcctaccaggtaggcacgagatagacacactgtgaccctctaacagcgtgatagcaatacatatgagcttttgttactacaggttccagaattctg
tgatcctatcgagtttccagcttcgaacactgctaattttgaaggtgttgaagtgatcaggaatagctagcgcgatctagactgcagcagtttatttctg
gttgaagcgagggcttgatcaacatcttcgttggcattttccagattgacaatggagcggaactcggccgaaatgctcaggttgcctgaacacctcgaca
caccgacattcacatggtacgaagctgtacatttcttgaggtgtagctggtaattctcacttgttgtgatagtgaggtgtgtaaaatctcagtgcgctca
gcgcagaagctcatggaccacgtcaacttctcgccactccaccaagcttctctcggtctgagttcaagcccaaaggctggtactgccaaggctgcagggc
aaatgcgtcgtctactgtacgacggctcgaagcttttctggcgcgtcaatgagacgttggacctctgcatttacgaagacttgtcggcgaactgtgtcac
catccgagccttccagcacaaatcaccccagaattcggaaggagagctaaagaaggactcaacagacgccataccagctctagacgtggattcacgtcga
ctgcgtcttgttcttgggatcgagtcagctcctgcggccactgggcgaatggcatatcccccaatgatgtcaagcccaagtctcgctcaaaggacaaagg
caacttcaacaccggcccactcaggcgaattgatcacaaagtatctgctcgctcgccttcaagctcgactggatgcaagtgaccgagtgaatcttcacct
acagaagattaacgatgacgacgttgatccagctgagcttgtgttggccacaaccgggggtgctcaagctctacccactgacctggcagttcgccgtcgt
catactatcgacgatgtcaaagaggcgcaaaaggaggtatctgtggcagctacacgactgaaaaatgcccgtattaaagctgaagaactgtccaacctgg
cgcgaatgacactcgacgctttctcgcaacaatatggcacaaacggtgaggaatcaaggatggtcagtcgacaacaagccaaagtcagcgcattagcatc
gtccgcatccaacgccatattgggtatgagtggtggtggccgacgctttacagttatggacagcaaacctgcttctgtttggatgcgagcatacgaccga
gtggtgctgcagaatgcggtggaacgcagcaaagaggtgatcggacgtctaccgcatcaagaggagaagatgggaccgattgacgaattcaagtagaacc
aggaatcctcgccattgcatcttaataaaacactcattgcactgaaagttgatattccccttgttacacttcacattcgatcaacaaattcaatgtgaat
tgattaaggttgagtggtcttgcgcgggtcatcccaagtggtgactcggttgatatgatcaatgaagaacactcggcctttggcatctgtcttctcttcc
caaccgaccggaagtggtgcgacttcatctgcatttcttggtgacgaatccgccgttgcgtcctctttttgctgacaaatgtaccggaggagggcttcgc
aataaagatcacgggactcctggttggaaaagttgagccttgcagtggatttccaaggcattgcgtcgtggttacccggtgattcaccgcggggtgtccc
ggatggcgatcgtttgctcatcacgagaacattcgggggcttggggctgtttttcagtcaaacaggcaagttagtggcgcttcctagacaatacacaaga
aacttactcccgaatccgaattgtagtgctcggtgaaatcttctgtgtcttcgggtgcatggccgggaaattagtcgctgcagtagttgcatgcagacga
tcgctttcctgcaattcataacggacgataatgtaaaagcacaataaagtagcagcacgtagtattgcaacgtactcggttgtggtaatctgtgatccgg
cgattcatatttgcgatccgagcttcatgagccgctcgatcttctcgcatccgtctggcaaatgtactcaatgattcactccttgtctttctaaagccac
aagtgcagcagttaggtgccaccgttgttaaaaccaaaaggatattcacttacgttgggctgctatcctgaacttcatcaactgaattccacaataccat
tagaagtgaaaaccacgacctatagcagatttgtttgaaagcacatttacgtttctcgccacagtcaactcctgatgctgtatacgcaacaacgtgcttg
aagcgtcgaagctccgcctgcgtctggaatctaccacccgcgttgcgttcatcaaaggcacagaatccagcgtgtgttgcgcgattcatgatgtggaact
tggagtgatccttcgacgtccaacccttctgctaatgctaagataagacgctattgtactaagaatacgtcgagcgtccatattgaccacaggaagcgaa
atgcagcgaaggcatccgagaaaaaactgaaaaggacttgatggctcttcaggccccgtttgatctatccatatacacgccggcgtatattcaaccggat
tctcctgtcaagagctaccacgatggagacactgcctggaggagctttctagctgccagaccacagttatatcttccaggtcgaactcctgtcatcgatg
aagatccaatcgatcgcagccggagactttggacgcatcaagagctcagtgagttcgcagaggtgatccagaatcgctctcatgctcaactgattttgca
ggagcgtacgctgcggagatggcatcaatctgctacccatattcaacgatgttttcgaggtttgcgtggcaggttgtccgtgttgcaacttcggagagag
ctgtttgaatatgcagctacacttgagagagccatggagctggctcgtcaacgacggaggcaccgaaaagctgctgttgcgatccagcgatgctatagat
cttaccacaaacttgtccttcaccaacagagagctgctatcatattgcagggtgcaagtaagcgctttatgcagcgactaagatgctggaaggctcgact
ggtaatacaacgagcagttcgatgctttctttggcgaatgcgttggcgacgatacagaagacgcatcagaaaactattaactgcagcaacaagacagcaa
cagcttgtgtcagccacggaaacatttaaacgagtgcgggaaaaggtcttacttcaccgccaagcagatacctgggcttctcatcctgaacgaatgcaga
ttctacttcgcacacgacaacgcaagcagaagctgcaagtttctcctgggcttcctcttctgaaaagtactggaagtagcagtgtaccagcgaagagtag
caacaaggcctggtctcaacagtacagcttaccagcagtccaccctttcagtcgaggtcaataaattcttgtccagtactgttgacagcaaaaacaaatg
agatgctgctttgaaaatgctgcaataaaaaattagactgcacatgtagatgcaaacacggacgatacttcaaaaaagcgttcaacagtctgctcgcgta
ctagcgcaaactcgcgacagcgcgtcaccaaccagactttttcgctgcttgttcgactccagtaatatctcgaatctcctcatgtacgtttccagaacca
cacgcggcagccagttgcggtgaattagccaaaaagcttcaagacgcttcgccaagcgcagtaattcggagcgatcacgtgttgtggacgcctgatattc
attacattgtgcactttgaagtatgacagtctggagtgctgcactataactctcgaactgttccagcatatcgctaccaagtgtttcgatagtcgcgttg
tgtacctcttctttctggttgcgcgtaactagtggggcactgttcaccaatctaagcgctgcatgatagaaaagctcatgtagcttcgtatcgtgtagat
ggtgctccaccgacaggaatgcagtgttactactctgaaaccgagcctgaatgtcatccgtactgttgaatgtcatatccagaatcataaatgtaagttc
tccagccttgacgcactccgtagactccttcacttcatctcggcacatttccatcctctctacccactgtcttgcagcacgctccttatcttgctggtaa
atcgcctgcgttttttggagactctcgatcttttgcttggtattagcgctcaatgtctccaagtgcgacttcgtagcagcaattgcgtcagctctgctga
cagacgagcgaaagagttcttctacaaacgatcgccacttgtccatctgccaatacaagtagccaattgtgtcggaaccagagcccgtaaaagctccttc
ttcatttacccacggtacatgttgcgccattgtcgtacaggttgcggtttgcatgagactcaacacttcacacacagcgaagaccagggtttcacacgct
cgataccgtcgattattcccccgcaaaagtactagcaattcccctaacacctcacatgtattatggagaaaactttgcacttcatcagttggcttaatac
cgagatgaagcagtaaagtctgctcgtcgtctctcacatcgcggcttttggccatcagcaataatctgtccgccacgtctgtccatggcaacgggttgtt
gattgtttgctcttcttcgtcttcatcctcgttgtcgctaatgacgatcacttctgcaagatgtcttggagctgccattcttccaactgccacatgcgat
tcgtataagagaaaagtcatgatcattgtattgacaagacatgctccaataaataaatgcagcgctctaatactgaattgctcttacatctggagttgtc
acaacttcaatttgtaaaggtttcatcgtcactcttctgatgtcatagaatcgaggtaaccgaaccggtcccaaatcgttttgaaccgcaaaagccagtg
gccccctgtctcccagagaaaaaaagagaaactccccatacattctcaaagagcaagacacccagaagaagaagctgctaaagtagaagcgaacgatctc
aaagcggttgggctggtaattcgtcccatttgcttcttccattttccctcggctgcccatcttccccttgctgtcgccggtcgtctgtttcctttgcatt
ccgactcgtccgttcagtcagttcttcaatcagtcggtcgtctgtacacgtcgctggctgtccgtcatttcgtctctgcataaagcagtttggacgtcag
attcccctcagttttgggccttatacaccctgttcaacgcacataacagaattgttcaaggtaatgatggcagaatttacatatgtagttagaagatagt
tttggctgctgctgtgcacgaagaaggcggtagacgccgtcgttttcgcactttgcaattggctattacaccacctacgcactcccacttctcccgctgt
tgggtcttccgtgatctattctggccgtagttgttgtcacgctcttgactgagagaaacgttacctcaggtgatggctcgttacaatggtgtgatgcagc
taatgagctgaacaatgatggaagtctccggctctcgagcccaccgatctcatgatgaagagtgatcgtcaactgggagaaccttgggggagtgtcgaga
cggcggtgttcgatgcctggcagtcctatatgctggaagataaccgagatgactcacttgttgcatgtgtgcacacttgtgtagataatgaacgttaata
tggagccaaccagcttcaccagtatgctggagcactcacagttcggcggagctctgcactctcagggtcaggcattcggccttcaagcgatgatgcagcc
agtgtccatgggagcttcacagttcgtgaagcaacaaccggttgaacaagttcaagctccacctccagccccggtgaagcttcctgccgatcagaaggta
gtgcactgttattggttgtcttgtgttgttctcgtgatgtaactaactgtcttgtcatttcttaatgttcaggttcccaacgtacttcagaacatgatga
gccgcagtaacagctccaagttgacgccgtcaagtgctgaggcgtccttgttgtcccttgtggacggtgagcttcgtgtctcatcgatttcaaacctccc
gatcttcctcaaggttctatcacgttgcaagacggaaccagagcagacgttggcacttgtggtgcttcgagcaacttcaactgcaagtgatcctaagctg
tcacatgcctgtgccaacgccttcgagaagagtggcgggctgcgtgttgctcgtgcgtgggtcgactctgctgtgacctggcagcacaatgacttgttgg
ttctactcttagaagtgctgcagaccttaccgttgcaattaactagtattacggaagcacgtatcaatgagccaattgtcaagttgcgcaagaatgctcg
tgaagagcgggtcaagcgcgctgcccaggatcttctcaagttttggcgtagcaagtttacagagaaggagaaggcctcggtgccgcaaccgacagcgaaa
gtaaaagatagcaagccgtcatcatccacgactacgccttctaccaagcccacagcttcacctccatctacgccggcaaaacctgtgtcagtgaagcagc
caaaggctttgaagaaacgttcaatcaagaggttagaacgactaccttttggtggtggcaatgcagtgtcaaggtctagtgatttgattggaaatctcat
gcagcggaagtctgcaaaggatgctgctgcggctgcgcaagcggaaaagaagaggagtgagaatgccgatagtagcagcaaaacgagcgataagaaggag
gacgttaactcatcagcttccagcagcgcaagtgagagttcgaccccgacaactagcactgatgactcgttatcgatgcctctaccaacgattcaaagct
tcaaggcggctgcatcctcgagttcgtcgactaaagagcggaaacgcattcgttgggcggatgaatctggcgaagaactcgtaaaggtgaagttgattga
gtcgtggcgagacctcgtcccttacgatccacgtcacgatgaccaatcctttaaggatgcgaagcttcgtgagcacgctaacgagcggaatgcgttgctc
gcacaacatcacaaggtgccacctgccgttgctgcttcgaagtcgcgggagtggagcacacctgcgtttatccgtctaccggaagctgtggcagctcgtg
tgaatggcaattcggtcacggacgagatgcacgtgcaagatagtcgtcgtcgtcatgtggatgagtatgtggtgttagctggggagatgccaattcagag
tccgaaggagtgggaacgcgtgaacgagcctcaccgcggtccaccattggagattccgctgagtgatgtggtcgaaagccagcctagcagcgttccgcca
gcttctactccgatgatggctcctccaacctctgctgcccctagctactctcgagagggatattcatctacaggttacgggcaagctccgggttacgatc
agcgaggttacaacgatcgtagtgagtacaatggtcgtcaagactcggaagctgatcgcaagctgcgtgaagccttaggtccgttacaagagaatacggt
ggcacttctcatggacaaccctgatgtggtgccgcaggtacttgacgaagcgcagcgcaacggaaaccgcattccggacgctcgtgtgtttgaaattgtg
gatcagtatcgtcgcggacgctatcaaccgccgcctaatgctggtggcccagcatatagtccttatggtagtcagcagcagtatggtggtgacatgggtc
ctggtgttggctatgatcgccagtaccagcaacagtatccaccgcagcagggagcctttattgctggaaagcggaaggcagaggctatgggtgctcccca
aaatgggatgcttgaacccccgcagtccctcaagaggccatcaaagaagacccgaggcacgctgccctgcaggtattttgcctcgccaatcggttgcaaa
cacggcgccaactgccactacgcgcatgttcagccggtgcctgctaacggccccgagcatatttataacaacaatgggccgatgatgggcggccgaggtg
caggacccatgatgggcggccctcctcccatggatcgatacggccccgtcagtggcatgccgcacggcgtccctcagggactccctggccctcatatgcg
tggaggaagatgaaaaccctggaatataacaagtcgtccaaacgtcacccccagcctaaagtctcaatctcgtgtgggcagagaagaaacctgcccagcg
taggtgcctaaaactcggagaacactacgtctccaccacgatattcatccgtcagaagatattctctaaaatacatcaaacgcaatattttacattaacg
cgaagagctatacgccatgtgaagaagaaaacgataaaaaatgttttggttgccaaatggagcattgtatattgccttttgtcctgttcgttattcgaac
ccacacctcacctagacgctaagcgtctgacgaggcgtagggaacaacacgtttgcagaggagagatgccccaggaccgttcaccctgtaacaggtgagg
ctgagcctagggctccgaaccgctagcgtgtttcgcttaagccttgaccgacgaggccttgcggctgctgcgacgcttggcgatctcgctggcacgacgg
tccttctgctccttaacgcgctgcagtgccataaggcgaaaaaggagcaggatagttccaaacattcgcgcatacatacagtcagtccctcatccaacaa
atatcacaataataaatggacgcacctgggcgtggagacggttgtactcggcggcctcacgctgcaccttctcgcgctgctgcaccttcttgagggcaat
ctggcgcttgtggtggagcgtacgcggggtgacaagacgctggatcttgggggccttgtcgttcttcttgccagtcttggactcgaacttacgacgaatc
acgtacttacgcacgtcgtcctccttggtcaggttgaacagcttgcggatgttcgaggcacgcttggggccaagacgacgcgggatctgcacgtcggtca
ggccggggacgtcagcctcaccggccttaacgaccaccaggttgagcaccgaaaggtccgggccgacaatgcaaccgcgcaccgacttgcgcttgcgctc
acccttgcgacggggacggtagcacgacttacccttggagagaagaagacgggcacggccgttggacaggacaccctgcttcatggggaaaccctgcttg
tcgttaccgcccgacacgcggaagatgaagcccttgaactcgtcgccgagaacgtcgccctccacctcctgggagatgcgcttctcgtagaaagcgcgga
gcttgtgctcgtcatcgacttcgagcaccttctgggcacccgtcagggggttggcaatgttgagcttcatgttggaatctgtaataatacaccagggttc
atcagtctcgtgtgttcaactatcattcacaggtagctagagaaaagcatgcgcacaaggttccgctttcgtacctcacaagacaataaggacaatggaa
ttggctcggacctgaattaaatgctcggcctcccaccgccaccaaccttcgctaggccatcacaggccaaccaaaacgctgcgactttggaaaataaata
aagagctatgctacacctattgttcgtttgtaactctccgcaaaatgttaagtacgcactcttggctaaatccgcatttgaaaaagcactttcctttgta
gttttgtgacagtagtgtgtgttgtggagatggtggcacacaacttgaggataccctacgagaatcgcttgcgttgccaaccgctcgtttgaagaacgtc
ttcagcctcaagagctcacttatcaagacgacatgggcaaccaagtgagtacacctgcagctactgagactgctgttagtcagagcggcggttgtccagt
gcagcatgataccaagaagtcggatggatgtcccgttcagcatgacgctaagaaggttgcgggtggttgccccgtgcagcatgacaagaaaccggcagtg
gccgacgccatggccggtggttgccctgtagtcagggacggcaaggaggaacaggaagtctacaatgtttatggccagcgcatcgacccgaccaacatga
tgccgtacaaccccaatcaggaccccaacgccgagcagcgctacccgctgcctcaagaccgcgtgcagtccacgatccccaagggcggaaccgagggcac
gtggttgtacccgtccgagcaaatgttcttcaatgctctcaagcgcaagggtaagggcgaggacgtgcacgagggcgacgtgagggctatcgtctccatt
cacaacaacatgaacgagcgcgcttgggcacaggtagagcattacgagaaggtgtgtcatccggacctcgagagttcaaagttgcttaagttctgcggtc
gaccggacaagcttacgcctatcgcttgggtcaagagtatgctcggatacggcaaacccttcgaccgtcacgactggactgttctacgcagtgacaacac
acaggtgcgctacgtgattgactactacttcgacgacgataaatccgtgcaggatgaagtgccggagctgcactcggaggacaaggttaaaagcatttcc
atgtatgctcgccctgctgtcgactcggtgagcgatctggtcgatcggattaagttccctgtcttgggattcctgaacggactaaagggccccgatcttt
ctgcccgttctgcgttggttgagcgctcccaggaggacaaggatgctctgccgcctctgtctgtggaggaagtcgagcagacgtttgccaaggttaagga
cacgtgcaagagttgcatgcaagaggtccagacttgcagcaacgaagtgcagtgctcacaggcagcgatggctctccagttgtgtatgggtcgcattatc
tgtccgccgcaagctactgcattcaccaaggcactcgagggtggcgaacagtccgcggttgaggctgcttttgacgccatgaacagcagtctggagcagt
tccaggagcgtggagctagcgctatgcaggagcaggctgtgcgtgaatccttggctaagaaataagcggcccgagattctgaaaccagctaaataacaca
atctagacgatttttataccgaattggcgcctgcttcctgtactgctactcgtcttcatcggggcaaacgatcacttgtccgcgggaatcaatgtattgg
tttcgtagatgcccagcgcgtgcctgttccactttgagattagtgaagaaatgttccgctaccggtagttgtcatgcacaacagtcaaaatgagccagca
ctgaatgtcgagttccacgtacggttttgagaccaagtagctgctaacgttcctcgctgttgattgagcagaacagtggtgtcgtgtagctgtttttccc
tggcacgcactcgctcaaccgttttgtagtgcaaaagtagctgatgcagatcgtcgtagtgcttgttcgctacgtgttctacagccgaaactccttttcg
atcgtggatgaacggatcggcgccatgttgtagaagtaattttgcacagtcgtacagaccatagcgagcgcagaagtgcaatgcagtttctccaaatgtg
ttctaatgacacaaagcataactcgaagaattgagtgtggtgcagaatgcagagcaaagaaactatacctgtgcgttgacatcgacctctagacccaaca
gatccacgagaatactgtggacatgttggcttcgtaacattagtgtggcaacatccttcatagaactcgctgcttcaagattccaatccttccagagaaa
atgaagtgctgtatcgccgtttgcagtcgtaagccacacgactgccccatgatccagtagacagcgcacgagttcaacacacaatgaacggcacgcagcc
atgagaggagtaatacccgacgttctgtcttcttgcacggttatctcgtctgtgtagccaccggaaacgagacgaacaggaatatttacgtctaagaacg
agtgaaacttgagccacgcaatcacgtcactgtgacaaacaccactaattaatccgaaaacaaccagtacagttggaataagtcacccctcaccgtgtag
gcgcagcatgcatcagtttccagaattgttccattccttcacgatggtgcacctcacttaatcgaattcgtcgttcagcttcagccctttgcacctgttc
cacttcgcctttcagtgatgtcgtgagtttaccgacataatattccatcttgagcgtccgtgggtacgttccaaacccaagctaagaactccgtttccta
cggtggaatcaaccttctcagaactattccacctcctcccaatccgcgacgatgcaccagcgagcagcatcttcttcttcgcggcgatctccatctcacg
ttccttctcgagcttcaactgcgagcctgcgatcggatacgtgtccttcatgtactggatgtgatattttccgcgtggattcagctgctcttgactggta
gacttttggtagcgatttgccagcaactgcagctcttccacgcccagatcgtcgaagcgagcgtagatgcctggaagactgcgggtggacgtcaacattt
cccctgtaatctcttcttcccgcttctgaactcgaatctcatctcttcttgccttcatttcagcagcatcaacattacgctcttcctctcgtcgttcctg
caaacatacatgggtcaacctatacaatgcaaattatatagagcttagcgtaccgcctccaatcggtaacgctgctgtatccgctctcgatgctgccgta
gatactccaagcgacggcgctccgcgtcatctccatcgtcttcatgtggcatcagtgcaagttgaactttaaaataggtcaatgatgaccatcattctct
gtacacaaaagctacacaattaatcgagactgaaactgagactgagacacacactcacattttgaactgataggagcgcagcgcgatgctggcgtcggcc
aagtccatggacgacgaggcggcgcggctggcagtgttgcgcgacccgaagcgcatggcagcattgctggtacgcgccttctcgtcctccatgctggagg
agacgcggaacggcagcgaggaagacgagatggtggaggagacgcaggaggaattccaggagctcgagagacgcgccagtgccggcactgcagctgaggc
aacaccgctgcgtgtagtgattcaccctgcgagcgaagaagacgaagatgatgcggaggaggaggaagaagtggatgaacaagaagaagaagcggggaag
ccgctggatgaagaagaactggaagccgcggctactgcgctgcagacggccacacgcatcgtcgaggagctacggctcaagatgatgcttaaggcggggg
agcaaatggagcgacagaaacatgatactgataacgagccaccgttctccacgaccggttcattgataacgactcctccgcggccggagaatagcccttc
agctaccggaggaggaccaggtataccggtacctcgagcacgtgtgcggaacaactctacctgcagtggctgcagcaaatcatttaacccattccatcgc
agcaagaattgtgcggcttgtggctacgcgttttgtcccaagtgttcggcgaagaatatcgtactaccgacttgtttcgggtatcgtgatgaagcggtgc
gcacgtgcgacccctgtgctaggtggttccagaaagctatggaccgctactttgatgcgatggagctgacaaaagaacaggatcaggaatctacagtaca
tcgcggcagtatgggtgaagttatgatcgaggagaagtcgcgctcactctcgaatttcgccaacaacattacggttccttcctcaaccgctagtgatggc
ctgctatcggtaattacgcggccgcgttcgtctgtttcgtccccagatcctgtgcctagttgcccttctgaagaggtcaccgaggaaagtgccaatcatg
acgaacagatcatggcttcatcgtcctcaacatctaagtcaaggcgacggcatcgacactcgtcgatatctgtctctccatccccgtcgatacacaagaa
caagccgtggttcagcggtcatttgcgtgcgatgcatgtgaatgataggctgccgcgaaaaagaaaggaagaggtgaaagtgaaggtggtgacactgaaa
ataacagccccgagcttcgatcatttacagcacgaagaagccggttgagtagtgtggcgtcatcgacgtccaaacggaagtacacgagcgaagacactgg
agataagaccgatggtcaggcaaacctcgacgatgcagaaggcttgacaagtgctagtgcaaacactgaacaagggttatcgatggtgacatccattgaa
tcgagtgacgacgccgaggacaacggttcttctcgaccccgacgaaaaactcggcgatctaagttttcaagatcggcaagttttgatttaacaaacttgc
catcagctgtatcccccaactcatcaggcggatcaccagacctgaagcgctgcaatacgttcggacctgacgaggctagagcgatagctgcagatatcgc
gagcaacggaagtggtcgttcgaacagtatgagatcactaaaagcatttgatgatagcgatatcgtggatgaacgtgcactccccgactcaccagatgtg
aagatgaaaagtgaggcaaagctatctgcggctgtgttgaggtttgctgtctacgaaatgggtgcgaaggaaggcgcaggtttgcgtcggacatttggat
ttactaaagcgaatccagtgctggaccggtatactctggagcttgattgccgccaacggatcgtacgggcgaagtctgtgtttatgcaccgcttctggtc
attccattgtgactcggtacaatcgtttgtatttggatcatctgaaggaatggcccggcttatcgtgtttaatggtggacaaggtaaccagtcacttgaa
ttaaaatttgcgaatgatgacgaacgggagcaattcaaacaagccatggatagttgccgatcatcacatttggatcggatgcgcgggtttgcttcaagga
ctgctatgtcgcttcctgctcgacccgaagttactgtttctcctgtactcaacactttgcgatctccaacacctcaagagccaaacactaccttctcagc
tgacgtgtcgacatcgatcgaatctgaattgagactgactcatgatactggtgacaattgtgatatcgattccccaactctgcagtcgattcacgtgcca
cttttgccaggagaactggtggttaagaacacagagcttgaagcgacactactgattggcccagctagcgatacctacgagtcagcccaagtctggggaa
gaattcgcggtaaaattgccgtgacaaattaccgggtgatttttacgccgtttgaccgcgtacaagtacagccacggtgcggtggtcagggtggtattgc
gtatatcccgctattcgcaattacccaggtccagctcctttatcctggcggccgacgaacaaaatctggacggacatattatgcaggcatgactggctct
gcttccattgtctctatcaattgcaaggatattcgtgtgatgagattccagcttgacacccacccttccgtttcagacgatcatacacacaaattacggg
cgacgatcgcaaaaatggctgattcttctcagcggtatactgttgtcgaacgaggaagtcccatcagaacatcatctcctggactgggaccactgccgaa
cgacacacttgaccaaggagatagcggacagagctctttgcaggagagcagggagccttcttctcatttaacgcacagttcatcgcggattccagcttat
gctgcatctccagtacttcgtccggatcggattctgactcttcctcgcgaaataagtggatcttttgcgttttcatattcaatcagcaatatccctcctg
agcaaaacggctggaatttattcgtcgacgaacgcgagttcaaacgccaaattggtggcgatcctgcagtttccccattcttaaaggttcgtacgtataa
tcatcgccaaaggtagattgctatggaatctaacactcgtctcctatgtctcagttttacaagaatgatcggggaaacatttgcaagtcgtacccatcaa
agttactcctcccagcgtctatgaattcctcgacgctggctaaagtggctgacttccgcgcgaagaaccgactgcccgtgatcacgtattaccaccgtcg
taatcggtgtgtactgactcgctccagtcagcctcttctaggcagtttgctctcgggcagctccaacgtctccgatcaactgctgttgggtgtgtatcgc
cgattaccggatattatcaagaaccagtcgcagtcgtcgcaatcttcccgacctatctatatatttgatgctcggaagccaaaggcatccacaggtaatc
gattaatgggcaagggtggcgtcgagactccgcaggattatccaggagccgttatccaccacctgaatatcgccaacatgtaccgtatgcagtcttcatt
catgggattgatgaaactgtttttacctggaggtattgacgattctgaccgaacgtggctatccagtgtggaatcgacgagatggctggatcatgtgcgc
ctggtactggatggtgcgctgaaaattgcgcgcgtattggagctagaaggagcttctgctcttgtgcattgcagtgatggctgggaccgaacagctcaac
tgtgtgctctagcgcaactgatgatcgatccgtacttccgtaccatacgtggatttgctactctagtggaaaaagattggctagcgtttggtcacaaata
cgcggagcggacttcaggggaccgtaaccgagacccgcagcgaaacaaagcctcaccgatcatgttccagtttatcgatgccgtgtggcagatgcaacgt
caatatccacgatcgttcgagttcaacgaacgctttttactgcatttggcgaattcgatgacctcggggctttatggaacattcctgtacgactcacggc
tccaacgagatgtgaatgaggtgaagtacaactcagtctcggtgtggacaccggtcctgttgcggccagagctgtactcaaacagtgactacgagatgta
taatggtcccatttggccctgggtgagctgcaaaatgcttcgcttgtgggagaactactttttccagtggcatcctaagttttacaagtgccaatgggcg
tgcagtttaatttaccacgggccgtccaactcacggggcagtacaagtgcgacagacggtggcgataaggaggcaaaggacatccagccgcgtcaaaccc
caccttctgagatcattcatgtgaaagatcctccagcgttagacctactggcaaccccaatcacctcgacaatcgatgaatatgacggcgagcacgaggt
cccaacgataagtctctcttcggatgatgaggacagctcaaagcggattcgaactgccagtggaacgtacacaaagaagtcatcaaaacggaatcttttc
agcttaacccgagggctccgtcaacgcgcacaaagcgaggagaacggaagtcaagatatacgctagaggcccgtaaactcagcaccaacgtaggaattgg
aaagcaggaatggtgaggttttgtttatactcggtagaatagaatttagttgccacttgctacagtttcctgtggacaagtgtcaatcacgatagaccct
ggtccggccgtcccacataatctcgacccatagaccttcgacaccacgccattaatgttcgactgggggccgagtccttcgataaccgcgccgattttgt
acttggatacttctccactctgcagttcgatgaatcgttcgaccaccacagcttgcttggcgaattcgggatcattccctagtttctcgaaaacatcgac
tgcgtcctcaatggtttccgtcacaaacgaaggtggagtttcccggaagaagatgtattctttggttggagtacgtcccgggtcccctaactggacgtgt
ttcaagccagtattcgagctgcgtttttgaagggcatagcttgagagttggtccgtattttcacttgaattgctgtctccttcttttgcttcaccttgcg
atgaagcattgctttcattttcattgccgtcaccaaacccaaatagatgcaagtctttcgagcgagccattggtgttgaccctggctcgccaacaaccgc
attcacatggtgtggtgttgagcctgggtggttaagccgattgtaatctccaatttgaccgttgaccggagtagcgctatcattactaccaccactttga
ctcaaattgctcgtgatcacattcaattttggttttggccgccctggtgacgacgtcgcagtagaatctgtcgcttcttgaggcgattgttcctaacacc
agcgcacaagaacgttagttattgaataaagattggtttttgagacacaacattacctttgtacttcgttttgatcgtgccttcaacttggcttcgttgg
aacgcaccaggaagcgttccagaagtgaagagggttgagatgagctctcacttgtcttgtttgtcccagtcaaacgtcgactaagttgcttgacctctgc
ggcgccaaggaaaggcataggctagaatgacaatttagggtcaggtcagtaattgctacgtatcaagccctgttgtctaccgacttactcgttcttggtc
gagtatcgccgcaacgtcgtcgtagcaatgcattaacagaaaatcacgaactagatgatgcaccgtcatttcctggttcgaccttgtaggctgttccatt
gtcgaggcagattttgtagtgtcggtgtcattttcaacactttgaactacgtctgcagcactgatctggctggtcttagcgcttacgctgccagtcaagt
tgtcgtcggcgcgtttgtgatggctgtcttcttccccatcgccttcgctgtcttgctgatcttctaccaagaactcaacgttagctcgttgttttctccg
ctgagatcgcgcatcatcaccccagtttgaagtcgacatcacgacttcatcggcaaagcaagtcttcttcacccgaggccgcggcactaccggctcgtca
tccaaggcccacacgttcatgttgtctttgaccggaaagaggaaggagaagtgtcagcgtcctcatctaaccttaggcgtgaaaaactatcaatacacat
gtcaccaaacaaaaatacaagtcttcaatgtagccatcttactcaccaaatggttttagccacacgtcacagatctcacaagtcacagatttcaccatga
agagctttgagaggactcaacacaagcttagctgcagcataaagatgtcgaggagccaacggagtcattcacggcagcgacgacatcaagttagctttgc
agtcagtcgcctacacccgccacagcttggatgatgctgccgcagcagaaaaaaatgagggaagatgagatcaccgcgacaagtttgctgaggcttcacg
cgtattgccgctacaccacactacatgtatatccagcctacgccgtgtgaatcttggggagtgtcgccaagtttgtggccaaccctagcgttcatgatct
gcgcggacgacgcgtgcatcgtgcttcgccccagctgccagaccgccaagatgtcctcaaaattggcagcaccaccgccacattgacccatcacagcaca
atcgagcgatatttttctgagatcctgaacggatgcagtgcgcctaccatcgacgaacatgcactcagttcctgttctgagctacatggacatccactcc
agaccagcactggatgaaaacatgttctgtatgcaatggccgaatctgacgcgggggttgtcattcccactttgcccagctcccaacacggctcgccaca
atgaatttcgccttgagctttgcgcgccgtatctgttgacgcgaagcggggcgttgccctcagtatttgagccgaagcgacatgcccagcctgaagagca
gcagagggcgttgcaattgacgacggtctcgagcgcggcgcttctctcagcattaatctcggagatcagagcgcagtcttgcggagaaagccgcgagtga
ggatagcaagaagatggtgtcggccctggtctgcactggcctccttcccctgcttgatgtgtgtgcaagcatctgcaggtgaggaatgatttggatcggc
ggatctctgcaatgcagacttgaactcgaaacttttggagttttgaagccttcgacacggtcacgttggagcgtgttctgcgattgttttgtaaaaaaaa
ttgtctccagtgatcgaaagcgtcgccacatcgacaacaaggctctgcttttgcaaagagcattccgtagccaagctccaaaaaatggcaaagcctgcgt
ggaggtgggaatcccggctcatctgtagcgctccagcttggagcccaagacgcaccaagcaagactgatggtctggaggaatcgctcgagtcttgcttgc
agagcggttcaagagctccacacatcttgctccgtttgcaccggaaaaaccggctaacctggccaatgttcaaaaatgccgaaacgcaacacgacgactt
cctcaacaatttattaagccactttactctaccaaacgcgatcttaccgaacgtgcagaagtgtacattccgttgtgcgttgtccattgaccaaagtcgt
ctacagggtacagtaccattgccgctttttcttcagtccagtgcctcctgatccagctttcaggggtcctggaaacgcgtaacaaccccctggaactctg
agcgaggcaacccgctcggctcagctcgtatttttactgctgccatcgctgcc