Description :
From Genome Similarity Track
Location :
Scaffold_20:674- 5300
Transcript NameFunction/comments
Hyaar_Emoy2803397hypothetical protein

Sequence
4626 bases(100 bases per row)
CATTGAAGTAGCGAGTTCTCTTTGCGACGCGTCTTCGATTACAGGCCTTCCAGGACTTTCCTGGAAGCACTTCCTACGTGACCTTAAGGGAGGCACGATC
AAACAGGTATGCTTGATCACCAACGAGGTGGTTACCGAGACAAACAAAGAGCATATGACGCGTCCTCGTCGCGCTGAACCAAAGTCAGCGCGTGAAGAAC
TATTTGAGTCGCAGTCATGGAACACTCTCCGAGAGTCTGGGAATCCTGTCTACGACATTGCTCGTGAGTATTCATATGTGTTCCCGGATAAGATACCGGC
TGAACTCCCTGCTGACCGTGGGGTTCGGCACGAGATTGATCTCGTGCCAGGTTGGAAGTATTGTGTGACACGGAAAAAAAGTGGCCGTTACCTCGAGATC
AAGTCGAGGCTATTGACGCATTCTTCGAAGGACGCCGAAGGCGGGTCACGTGCGTGAGAGTATCTCACCACACTCGAGTCCAACCTTCTGCGTGAAGAAG
GCTACGGGAGGCTGGCGAATAGTGCATGTGTTTAACAAACTAAATGATGCCACTATTCCTGCACAAACGCCTATTCCCAGGAAGGACATGGTGTTAAACG
CCATGTCAGGGAGCTTCATCTTTAGCGCCGTCGATATAACCGATCGCTTTTACCAGATTCTGATGAGAGAGAGCGACATACCACTCACAGCAGTTAGCAC
CCCGAGTGGCATGCTATGGGAATGGCTAGTAATGCCACAAGGGTTGAAGAATGCACCTGCCACTTTTAATCGCATGGTGTCTCAGGTGCTGAGACCATTA
CGGGACTTTGCTCCCAGTTACTTCGACGATATCTTCGTCCACAGTCGCGCTGAGGGCGACCTTAGCGAGGTCCAGGTTCATCTTCAGCACTTGAAAAGAG
TATTCCAAGTCATGCGAGAGAACAAGCTCTATGCGAATCTCAAGAAGTGTGTCTTCTGCGCACCGGAAATTCCGGTGCTGGGTTGCTATGTGAGTAAATC
AGGCGTTCGAGCTGATCCACGGAAAGTTTCGACCATCTGTTCTCGGCCCACACCCAAGAACCCCACGGAATTACGTCAGTAGCTTGGCTTGGCTAATTAC
TTGCATAAGTATACAAAGAACCACGCCGGTTCTATACAGCCTTTATCATCACTTTTGAACAAAGACGCCACGTGGTCGTGGCGTCCTGAACATCAAGCAG
CCTTCGACGCAGTGAAGAAGAGCCTGGCGTCAGCGCCAGTGCTGGTCCTACCGGACGGCTCCAAGCCATTTCACGTCGTATGCGATGCAAGTGAGTTCGC
GATCGGTTGTGCCCTCATGCAGTTTGATCATGAGGGCCGTGAACGAGTCGTGAGCTATAACTCACGACAAATGAAGTCAGCGGAAAAGAACTGTCCAGTT
CACGACAAGGAGTTGTTATCGATGCGCTACGCACTCATCAAGTTCCGCGTTCACCTACCCGGTGAACGCACGTTTGCTTTGTACACTGATCACGCATCGC
TGAGCACAGCGAGGAAGAGTCCGCACCTTTCCCAGCAAATGGCACGGTGGCTTTCGTTTTTCTCCGAGTATAATTTCGTCTTGCATTACAAGCCGGGCAA
GAACAACATTCTTGCCGACGCTTTGTCGAGACGTCCCGATTATGATACTCGGACAGCGTTGAGTCGTCAGGCGACTGACGACGAAGAAGAGGATGATCGT
TGTGTGATGTGTGTGTCGCTGAACTTAACTCGGGTCAGTCCCGAGCTGTGCTTATTCGACGAAATCGTCGCGGATTACGCGAATGATCCAGACTACGCCG
ATATAATCGCTTATCTACGCGGACACAGTGACGTTGCAACTGGGTGCTCTTTCGAGAACCAAGCGTGATCATATTCTGCGATATAGTTTGGACGGGGACC
TAATCCTGTACAGCATCGATCAGTTCGATGTTCCTCGTACGGTGATCGCCAATGACATGGATTTGCGCGCTCGAATTATTCATGAGTACCATGATGCTCC
AACTGGTGGTCATCTCGGTCGCGAAAAGACTTTCGCGGCTGCGACTTCTTCTGGCCTCACATGTACAAGTGGGTGCGCAACTGGATTCGTACGTGTGAAA
TCTGTCAAAGAGTGAAGCCATCCATCGTCCATCATCGCAGGCTCCCCTGCGACCGTTGCCAATACCAACTGAGGCTTGACGCTCAGTTTCCATGGATTTT
ATCTACGGGCTCGCACCCGATAGTCAAGTCAGAACGGGTATTCTGGTATTCGTGGACATATTTAGCAAGATGACACATCTGGTTCCTGTTCATGCTAAGG
TCACCGCGGCAGAAACCGCAATGTATTTCATCGACGCTGTGTTTCGCAATCATGGATTGCCGGAGAACATTGTTTCGGATCGCGATCCTCGATTCACATC
CGCGTTCTGGACGTCACTTTTCGAGCTTCTTGGTACGAAACTACGTATGTCGACAGCGGCCCATCCGGAAACGGACGGGAAAACCGAGCGAGTAGACCGA
GTACTCGAAGATGTCCTTCGAAGTCACGCTATGTCCTTCACGAGTTGGAGTGCATTCCTACCACTTGCTGAGTTTGCGCTCAACAATGCTGTACACGCGT
CGACAGGTTTGACGCCATTTTTTGTGAATTTGGCTCGACATCCTCGATTTCCTACACTACTCGCCGTTGGTCGCCCCACGGCTCCTCGTGACTCCACTCT
GGGGGAGGGATGAAAGTGATAAACAACGGTCGAGTGCAGCCCAGGGTATTTTGAACGCGAATGTCGTCACCCGATCCAAGGCGAAGTCTACTATTGTGAC
GCCACGTGGCGTGGCGTCCCCGTTAGCTCGCTGGACTGCGCAGAAGCTGATTGACCCGTCTTCGGCTCAACCTGTGCCTTCTCCGAAGCCATCTACGCGC
CGATTGAGTCGGTGCGACCAATTGATGATGCGGCTGTGTCGGAGTTCATACTCTAACGTCAAGCCATCACCCGATTTGTACGTGACGCACTTCACGCTGC
AGTGGAAAAACAGAAAGAAAATGCGGACAAACATGGCAGGAAAAATATGAACAAGTTCGTTAAAGGTGATCGTGTATTACTCTCTACAGAGGGTTTAGGG
GATTCGGCGGTTACTAACTTAGGCGCGAGCAAACTCGCGCCACGTTTCATAGGACCATTCAAGGTTCTCAAGGTGATTGGTGATGCCTACACGCTGGACA
TCCCTACGTCGCTGCGCCTTCACCCGACGTTCTACGTCCGGAGGCTTAAGCAGTATCGCTCGGCTACGCTTCACGGGTTGGCTCCGATGATGGGGTCCGA
GGCTTGTAAGTCGGCCTCCCATCCCGTCTTGCTCGACGCGCCAATGACATCGAATGCGGCTGAGTTCCCATCTGTGCATTCCCATGAACCTGGCGTTCCA
GGTTCCTCATCCGTTCGAGCAGCTCACGGTTCGACTGACGGATCTCACTCGCAGTCTTCTCCGCCTGTACAGAACGCTCGAGAGCCACCTCGGCTTCCAG
CTGAGCGTCAGCAGCCGTGTTCACAGCCTCGTCAACATCGTCCTGGGCAACCAGGACGCCAGCGTTATCTCCGCGAGGGCCCACCGCCGCTTGTCGATGC
GGAAGGCCGGGTGCGCTGGATAGTGGATCATATCGTTGATCACAAGGATCCATCCACTGCTGCAGCATGATCGACCCACGTGGCGCACGCGGTACCAACC
GCGCGCCAGTATCGCATACGCTGGCTTGGGTTTCCACCCGAGCAGGATTCGTGGGAGCCGCTTTCCTCACTCTTTCGCGAAGTTCAAGATGTCGTTCGGG
ACTATGAGTCCATGCTGTCGGGGCACACCGACGTGAATGCAGGGGTGAATGTTCTCGTGGTGAACGAGAACGGCGAGACGAACGATGACGTGAACGAGAC
CATCATGGTGAATACGTGTCACCACGACCACGAGAACGAGACCTTGATGAGTACCGCACATCAAGAAGGGCGGGCGAACGCATCGCCACTCTGCGCTGAC
TATCCAGTGGAGATCGACTCCGATGTCGAAAGTGGTATTGCCGGCGAGGCACACCGCGAGTAGTTGCAGCCCTCAACTCATGCATACTGCGCTCGTACCT
CCCGATCCAAGATTGCTCGAGTTCACTGAGCGTCCACGAGATAATCTGCTGATCCATGACGCGGGCTGTTGCACTCCCGCTGATTGTGCTCGGGAGTGGT
GTGAAGTTGGGAGTCGCTTCGGTGTTCATCGTGCTTCGGTTGTGGAGGCTTGTCATCGCGACAGTTGTGCACTCACGGTTGGTGAGTGCTGTTTTGAGAA
GGGGGTGATGTAATGGGCCACCCCGTTACATAAGTAGTTTCTATTAAAGTTTCCATGTTACTTAAGTAGGAGAGCTACTTCCGGACTAGCGGATGTAGCA
TGTCGTATATCTTAGTGGGATTAATGAGGTCGGACTCATTATTAGCCAGTAAGATATCGACACGTAGATCGAGTGGTCTCCATGAGTCCAGGGAGCCACT
CGTACTTAGGATCTAAAGAAACAAAAATATAAACGGAGTTAAATCTACTTAATACCTAAGACTTGGGCTTGAGTCTTCCTCAAGCGTTAGTGTAAGCTAA
GTACGGGTTGTTCTAGCCCCGTTACA