Description :
From Genome Similarity Track
Location :
Scaffold_1490:674- 3800
Sequence
3126 bases(100 bases per row)
GACGCATCGTCGACCCCTTGTCGAAGGTCGCGTTCGCCATGTCATGTCTTGGCGGACGTGCAAGAAGTTGGGCGTATGGACGCCGACTCTCGGGTCCTAC
GTGCTTTAGCACGTACGAGGGTTTCAAGGAAGAGCTCAGACAAGCGTTTGAGCCACCGCAAAACGAGTTCCGGTCGAGGGCGGAGTTCCTCGACCTGCAG
CAGGGCAAGCATGATGTCCATGCTTACGCTCAGAGAGCACGGTACTTGGTCTCGAACATCGTGACCAATCCGATCGACGAGGCGACCAAGGTCGTCACGT
TCATGAAGGGACTCAGAGATGGGCCTGTGAAGACCTATCTCTTCCGTGAGTACCCGAGTACTCTCGAAGCTGCAATTACTCTNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGTACGTGGACGTACTTCCGGAAGAGATCCCTGCGGAACTTCCGCAGG
ACTAGGGCATCCAGCACGAGATTGATCTCGTGCCGGGGACGAAGTACTGTGTCACGCGGCAGTGGCCACTGCCACGAGAGCAGGTCAAGGCGATCGACGA
CTTCTTTGAGAGTCGTCGCAAAGCTGGACAAGTGCGGGAATCGAAATCCCCACACAGTGCTCCGACGTTCTGTGTCAAGAAGCCACAGGGCGGTTGGCGC
ATCGTTCATGCGTACAACAAGCTGAACGATGCGACGATACCGGCGCAGACACCGATACCGCGAAAAGATGCCATCATCGATTCGATGGCCAGGAGCACTA
TCTACAGTGCTCTTGATCTGTGCGATGGATTCTATCAGATCCGCATGCGTGAGAGCGATATCCCTCTCACGGCAGTGAGCACGCCGAGCGGCATGCTCTG
GGAGTGGCTAGTGATGCCACAGGGTCTGAAGAACGCCCCTGCGACCTTCACCAGGTGCGTGACGCACTTGTTGCGCTCGGTGCGCGACTTCGCACCGAGC
TACTTCGACGATGTGTTCGTCCACAGCCGGGCTGCGGACGGAATGAGCGATGTTGAGATGCACAGGGTGCATCTCCGGAAGCTGCTTGCGCTCATGCGCA
AGCACAAGCTCTATGCGAACCTGAAGAAGTGCATCTTCGTGGCGAGCGAGATACCCGTGCTCGGGTGTCTCGTCGGGAAGAACGGTGTCCGCCCTGACCC
TGAGAAGGTCAGAGTGATCAATGAGTGGCCGACGCCGTCGAACGTCAAGGAACTGCGGTAGTTCCTTGGCTTGGCCACGTACTTGTGCAAGTACGTGAAG
GACTACGCGGGCATGATACGCCCGCTGTCACAGCTCCTGAAGAAGGACGCCGAGTGGGATTGGACTGCTGAGAATCAGCAGGCCTTTGATGCAGTCAAGC
GGGGCATGACGGAGGCGCCGATCTTGGCGGTGGCCGACCAAGATCGCCCATTCCACGTTGTGTTTGACGCATCCGACTTCGCAATCGGATTGCGTTGATG
CAGCACGATCACGAGGGTCGTGATCGTGTCGTCTACTACAAATCGCGTCAGCTGAAGCCAGCTGAGCGCAACTACCCGGTACATGACAAGGAGCTCCTTG
CCATGAAGTACGCACTCGCGAAGTTCCGAGTGTATCTACTCGGAAGCAAACCGTTCGTGGTCTATACGGACCACGCGTCGTTGCGGACGGCTGTGAAGTC
GCCGCACATCTCGCAACGGATGGCGAGATGGCTCTCATTCTTCGCAGAGTATAACTTCCGGGTTGAGTACAAACCCGGAAGACTCAATGTGGTGGCCGAC
GCGCTCTCGCGTCGACCTGACTACAC