Description :
From Genome Similarity Track
Location :
Scaffold_765:674- 2290
Sequence
1616 bases(100 bases per row)
ACGTTCTTGTAGCTCTTGGGGAGACTTCGCAGTAAGCAGATCGCCACGTCCTCGTCCTCCATCTTGGCGCCGATGCTGCTGAGCTTGGCGCTGATGTTGA
GGACCTCGTTGCAATGATGCAAGACATTGCCGCCTTCCGACATCTCCATGCTGAAGAGTTGGCGCTTCAGGTAGATGCGACCAGCCTTCTGCGACCCACC
ATACAGCGTCTTCAAGCGCGTCCACGCGCCCCACGCTTCCTCGCAGTCATCAACCACGTGATGGTAGTCCGCGTTCATGTGAAGCAACATCAGTCCGAAC
GCAATGTTGCTCGCCTTGATGTAGTCGTCCTTGGTCCGGATGTCCGTGAAGCTCGGCGTCGTTTCCCGGCTCACTACGTGCCATACCGACTTGGTCAGAA
AAACGCCACGCATGTAGCGGTTCCACGTCGCGTTGTTGTCACCGTTGAACTTGTCGATGGCGACCTCGGTTGAGGCCGTTGTCAAGAAGGCGTCTCGTCC
AGCTTCGGCATACCAGTAAAACCGGTTTCCAAGGACCCCGCGATGTTTACGGTAAGTCAATTGCGCAAACGGATGTATGCGCAAACAGATGATTGGACGA
GCAGGATGATTGGACGAGTCCAGAGTGTTGGTGTCTGGATGCACCACATGATTGGATGCAGACTAGGACGTAAGACAGCGTAAGCTCCAATAAATCAATC
ACTTTGCATTTTATCATTTAGTGCACAAACGACCTATCTTTTTGGTTATGAGCCCAAGCCCCGCAGACTCTGCCCAAGACTACGCCTACGCCATGGACGC
CACTTCAACGACCGCCCGCATCAACAAGTTCGACGGAACCAACTTTCACACGTGGAAGTTCAAGATGCAGATGGTGCTGGAAGAGCGCGACCTGTGGAAA
GTCGTCAGTGGCGAACTGAAGATGGAGCACTGCGCTACCTCGTTGGACCAAGCGACGTTCAAGCGGAAGTCGTGCAAGGCGCTGGCGATCATCTGTCTCG
CAATGGAGGATTCGCAGCTGCCGTTGGTTCGGTCGGCGAATGGTGCGCATGATGCCTGGTCAAGGCTGGAAGGACACTTCGAGAAGAAGAGTTTGGCGAA
CAAGCTCTTCCATCGTCGACGTTTCTTCACCACGATGATGGAAGAAGGTGATGATGTGCTGGAGCACATCAACAAGCTCTTCCTTCGTCGACGTTTCTTC
ACCACGATGATGGAAGAAGGTGATGATGTGCTGGAGCACATCAACAAGATCAAGACGCTGGCGGAGCAGCTCGACGCAGTGGGCGCTCCGGTCAGCGAGG
ACGACTTGGTGATCACGCTTCTGGCAAGTCTAAGCGAGTCGTACCAGTTCCTCATCACGGCGTTGGAGTCGAGAGCTGACTCACTGTCGTGGGAACTCGT
GACGGCTCGGCTGCTGCATGAGGACATGAAGCGCAAAGAGCAAGGTGGCGGTGCGGACGGCGCCGCGCACGGTCAAGCGTTCATGACGAGTGACAACGGG
AAGCGTAAGGGACGACAGGCGCCAAAGACAAGCGCGTGTCACTACTGCGGCGAACAAGGACATTGGATCGCCAAGTTTTCCGGTGAGGATTTCGTGAAAA
TGCGGGAGCGACAGAG