Description :
From Genome Similarity Track
Location :
Scaffold_331:6739- 8241
Sequence
1502 bases(100 bases per row)
CCAGTCGAGTGTCGAAAACCGAGTGTAGACCCGGATTCGCTGTCCAACGAGTTGAGTATAACACACCTTCAGTATCAGCAGAAGCGCGAGGACCTCTTTC
TCGGCCGGGTGATAATTCATCTTAGCATCCTTCAAAACACGTCCGCAGAAGCGAACGGGGTGTAGTTTGCCCTCGTCCTCTTGCATCAACGTGAAACTTT
GAGCCCACTCGTTGGCGAACAACATTTCCTTCTTCCGGTCGAAGTGTCGTAGTATCGGTGCTGCCGAAACCTTCTGTTGGAGCATCGCGAAGCTGTGCTT
AACCGCGGTGAGGTCACCCCCGGGCTGGAAGTCCTCGTCCTTAAGCTGGTACAGCGCTGCTCCATAGATCGCGAAGTCTTGGATGAAGCGACTGAAATAG
TTGAGTGCCCCAAGGAATGACTGCATTCCTTTCCTCGTTGACGGGAACGGAAGCTCGGCCACCCCAGCCAGCTTCTTAGCGTCCGGTCGGATACATTCTG
CCGAGACTTCGTGGGACAGGAAGTCTACTTTGGACTGCACAAAGATGCTCTTCGTGAAGCTGATACTAATACGGCACTCTTCAAACCGTGCCAGCAATCG
GTCTAGCGTCGCCAAGCACGACTCGAAAGTCTCGGCACCGAACCAGATATCATCCACGAATGACCGGCGACTGAATACTGGTGTCAACGAGGAGTCATCG
GGCTCCCCGTTGGCGAACATGTCGGCGATAGGGCTGTTGACCAGTTCGGCTACAGCTCCCTTACCAAGCGAGTTGTCTCGGTCGGCCTCGAACTTGGTCC
GGAATGGCTTTGCCGTGCCAGTCGAAGCCTCGTTCACCCCAGCATGAGCTTCCTTGTCATGTTCTTCGGCTAGACGCATGCGCACCGAGAATTTAAACCA
TCCTCCCGTCGGTTGGACGAAGCCCCAAAGCGCGTTGTCAATCATGTGTTGATAGATCATCGGTGCGTTCTTCAGGCCGAAAGGCATACGCAACCATTCG
AAGTGCCCCAGTGCGCAGACGAAAACAGAGATCTTCCGAGCTCGTTCGGTCATCATAATGGCCCAGAAGCCGCTAGCGGCGTCAAGCGAGCAAAATCACA
AGTACGCCTCCATGTCCGTCAGCAAGTCATCCACCAGGGGCATGGCGTACTCCATAATCTCGTTGATCGCATTAACGAGTTTGTAGTCGATACACAGGCG
GATATCCACCCCATTCTTCTTCAGGACGATGACGATTGCCGACGCCCATGGGCTGTCCGAGAAGGAGATAAGCCCGGCCTTCAACAGACCCTTCAGCAAT
TCGTACAGCTTACCGAGGAAGCGAAGCGTGGTCCGCCGAGCCTTCTGCTTGATTGGCGCGTGCCCCTGTACATTGATATCACACACGACCCCGTAGGCTG
GAGGCGGCAGGGCGTTACCGCTCGCAATCATGATCTTCTCGTGGCTCTTCAGCACATCGACCAGGGCCGTCTGCTGCTTCACGCTGAGTTCGTCACTCTG
GA