Description :
From Genome Similarity Track
Location :
Scaffold_1356:6735- 9060
Sequence
2325 bases(100 bases per row)
AAGGGAATGTTTGACGACTTCCAGAATGAGTGGAGTACAAGAACAACACGAGAACTGGTTTATTGGGATGTATGTGGCGATCATGACGCTGCTGGCCCTC
GTGCTCGTGAAGATCAATCGGTTGACGTCCTCGGAGGTAGTTGGAGGTCCAGACTCGAAGGAGATGAGGCACGAAACACGCGCGGACGGTGGTGGTCGAA
TCGATCTGGATAGTGAAGCTATTCGACTCGCGCCACTCACGTCTGTCACAGTGGGCCCGACTGCATTGTTGCGCTTGACATGCGTGTGGTTCTAGCGCTC
GAAAAAGTGCGCAAGTAGATCAGAGTAGGTGAGTACTCTAACAAGTGGTACAGTTATAAACTTTGAAATTGAGCGAGCTCGATTTATCTCGGGATAAAAT
TGCAATCCGAGCTCTCCACAAAGCCATCAGTGGTCACACGAGAGAAGCGAAAGTACGGAGAGATTTCTCTGCTTAGTCCACCTCTCAATAGCTCAAAGAG
ACAAGACACGACGTTTGGAGGATATCTCACATAGAACGAGAGCAGACTGTTTTTCGTGAAATTATGCGATTTCCCCCCAGAGTAGGTAGGTACTCTAAAA
CCAGAGAACCCGAAGAAAACAAGCCAGAAACTCAATTTTGCTTAATTCTACCTTCTGATCTAGCGTTTTCAAGTGCTACATGCATGGAAATGAAAATTCT
CTGCGAAATTCACCTCTCAATACGATAGAACACGACTTGTGGAGGTTACTTCTCATCGAAATCTTCCTCCGATGAAAAAAATCTCAACTAGCTGGTGGCT
TTCATTCACAATTCCTTCCTTCAGTTCTTCACATTCCCCACTTGTGTTCGTCTCCAAAGAACGCGCTTCGACTCGCACGCCATGACAGTTACCAAGGACA
ACGCGCCGGTCGTCTCCAGCAGTGACGTCTCACAGGAGAGGCTGCTGTGCGCTGGACTCGTCGCCCTCCTACTCGGATATGCTACGTGGGTCGCTCAAAT
GGTGCTGCTCAGGAACGTCCAGTTCACGATGCTCGCTACCAAGTACGACTTTAAGCCCATTTCAACGCTTGCGAGCTCGCTCGTCGCGCTCTTTGAAGGC
TCTGTCGTCACTGGGGCGATCACCGCAGTCTGCGTGGCGTGGAGTGTCAAGCCGCGTGCTACTGGTGGCAACATTGTGGTCGCTGCGGTGCATGCCGTCG
GTGTCGTGATACTGGTTGTGATGGTGTGGGAGCACGTTGACAGTTCCCGCAGAGCAGCTCAGGAAGATCAGTTTGCGATCAAGTACAATGAATTCTACTG
CAACGCTCGTACGCTGCAGGTCTGCGTCGAGGAGGTTGATAAATACCCAGCAGTGCTACCGCGACTCGTGTTTGGGGACAAGACCACCAGTCTCAACAGC
TCCAGTGGTAGCAATGACCCGAGCGTTTGGCTCCACTGCCGAGCGCTGGTGAACGCTCGAATGACAGAGATCAAGCACAAGAAGCTTGCCTCCAACACTG
GGCTTGTGAGCAAACCCACGCAAACGTTTCTGGAAGACTCGACGATCACGGTCAAAGGAGGCCTGTGGTGTGGCAGTATGCTGCAGCTTCAAATGAACTC
GACTAAGCCATTCGTCGCCACGAATTCCAGCCAGCAGCCGCTGCTGGGCTCGCCTTACGAGGCCAATAAGCGCATGTTTGACACCTTCAAGAGCGAGCCG
GACAAGCAGCTGCGCACCGGTTTCTTGTTCCTTGGCGCCCAGCAGGTGCTCATGACACTCCAGGCCGCTGTGCTCTTCAGGCTGACTGAAGGACTCTCAG
CGAGGTCGTCCGAGGCGGAGAGCTAACAGTCGCCTCCCAGCTCTCCTCTCGATCCAAGTGAGTGTTGTGATCTTGTAGATAGCGATTCCAACTAGCTGAA
CATGTATTTTGCGTGAATTGATTTCCGTGGAGTTGTTGTGGTTTCTCTCTTTTAGAGCACCTCCATCGACGTCCCCTTTGAAGTTCTTCCAGCAATATCC
CATGCTTTGCGAGGCAAGACAACTAGTCTCGACGCTCTCCGTGTTCGTCTTTTTCATGGGGATCAGTGGTGAACAAGTGGATGCGAACGACAGTGTTGAG
TCAATCTGATTGTCGACAAACTACTGCGCCGTAGAGATCCTTGTGTTGTTTATCGTACTCCTTGTACTAGAATCATACAGTTTCGTACTCTCATGGACCA
GCAGGATTTAATCCAATAAATCTTCACAACTTTCTCCGATCTGCATGCAGCGATGAAGGATGGGAGTATCATTCAAGGAAACGCACCAGAGCATGAATGC
TTCCCACAGACAGTGGAGTCTGATT