Description :
From Genome Similarity Track
Location :
contig_10:6734- 7757
Sequence
1023 bases(100 bases per row)
TTGAGAAATAGTAGTACCATTGAACTCCGCACATGTTGAAACGTAGAATCCTACGTTTTCAATGCTCTAACGTTACTATTAAAGAAGTGTGTAAAAAGTA
CAGAGAGGCAAGTCTTTGACACACGCGAGTCGGTGCATTCAATTCGCCATATGTATAAACACGGATTCCCAAGTTTTCAGCTACTCCTGACGATGGTAGT
TTTTCTATCTCCTGATTGGCTAGGAAGCTGTGCTGTCGAGGTTTATGCACTAACCCTGAATGACTTGGATTTCTATGCATGACTTCGAGTTTGTATGGCC
CCCGAACATGATAAATTGACCGAAAATGGTCGCGGAGTTTTCATATAGGAAACCCGAGCCAAAAATGGGAGGACACTCACCTCGGAGAAGACCCGGAGCG
TTCATATAGGAAAGCCGAGCCAATAAATGGAGGACACGGAGCACCGGCCTACCCTTCTCCGGTTTGTCTTGATTTCACTATACTGTCCTCTCGTGTATAG
GGACCCTCTACCCCATACAAACGCCTTGTCGAGTAGTCATCGCACGATAGTAATACCATGGAACGGAGCACATTCTGAAACGTAGAGTCCCCATGTTTCA
GAGCTCTAACGTTGATATTGAGGAAGTTGTAAGAAAGTCCATAACGGCTCGTCCGTTGAGAAATAGTAGTACCATTGAACTCCGCACATGTTGAAACGTA
GAATCCTACGTTTTCAATGCTCTAACGTTACTATTAAAGAAGTGTGTAAAAAGTACAGAGAGGCAAGTCTTTGACACACGCGAGTCGGTGCATTCAATTC
GCCATATGTATAAACACGGATTCCCAAGTTTTCAGCTACTCCTGACGATGGTAGTTTTTCTATCTCCTGATTGGCTAGGAAGCTGTGCTGTCGAGGTTTA
TGCACTAACCCTGAATGACTTGGATTTCTATGCATGACTTCGAGTTTGTATGGCCCCCGAACATGATAAATTGACCGAAAATGGTCGCGGAGTTTTCATA
TAGGAAACCCGAGCCAAAAATGG