Description :
From Genome Similarity Track
Location :
contig_122:67325- 68762
Transcript NameFunction/comments
g13995.t1hypothetical protein

Sequence
1437 bases(100 bases per row)
GGCTCAATCGAATGTAAAGTTAGTCTGGAAAGGAAGCCTCGGCGTGGTGCGACCTGAACCAAAAGTAATTCATCCCGGGGGAGGCCATAGCCGCTGTTTC
CTCTAGGGAGTCCCCTCCTACCGATACCCGCATACTTACTGACTGCAACTAAGACTGCGGCCGTGTATGCCTCGAGAGTTCCGACGATGCAGTCTGGCGC
TCGTTGGGGTAACGTATAGAGCGACACGCAGGGACGCTTTACCGGTGGTGGGGATTCTGGCAAGTATTTCGGCGGTGAGTCTGTTATTCTAGTGGGTCCA
CTCGTTTGCTGCACACCAAACAGCGAGCAACGAACTGGGCCCGCGCCATATGAAGAATGTAACTGGTAGTTGCGCATGCTCTGTTGGTAGGCACCAAGTT
AAACAGCAGCGATTGGCCTCGACTGCAGGAGACGAGTTTCACGTTAGCTCGCCGGTAAATGCGCACTCGATTCCAAACACCAGCCACCACAGCACGGTCT
GTGCTACAGACGAGTCTCTACGTCCACACTGATCCACCACTGCCAGTCAGCCCAAATCGAACTTTTCAGCCAGCCAGCAAGTATGTATACGGCCGAACGA
GTCAAAACTTTCGGTGTGCGCGGCAACGAACTCGCCAACTTGCTTGCTTGGATGATCTACGCGAAGCAAAAACACGCGACGGCGAGTACGTACCCCCTGC
CGGTCGGCCCATACAACGACCAAGTCAACCAGATAGAAACGGCCACAGCCGGGCCGCTCGACCGAAATTAACGAGCAAGCGTAACCTTGAATAACCTGCG
CTGTCACACCCGCCGATCAAGTCCAAGCCGACCGATTGAATGCGCGCATACCACCCTCGTCACAGACGCCGCGCTTGATACTCAAGATGCAGCTCCAAGC
ACCGCCACGGCCAGCAATGCCCTCGCACACTTGGCCATTCTGCATTTCACCAGCTACTGGTCAAGCAAAGCAACCTACCAACCAACGCAAGTCGACATGG
CTCCACTGCCATCTGCAGCGCAAGCAACAGCCACGCCCGACGTGGCACCCAACGCCAGTGCCGCGCAGTGCTTCGACGACCTGGTCGACAAGGTCGAAAG
TGGCTACGCGGCCATGCCCACAACCCCCAAGACTGCCACCGCCGCACCGGCCTTCGCCCCCGTCAAGCCGCAGGGTCTGGCACGCTTCGCCGTGCAGAGC
GTGCACATGCGCGAGTGCTTCGCCGAGTTCCTCGGCACCTTCGTCATGATCGTCTTCGGCATGGGCGTGAACAACCAAGTGACCAACTCGCAGGATGCCA
ACGGCACGTGGCTCAGCATCAACATGTGCTGGGGAATTGGCGTGCTCATCGGCGTGTACTGCTCCGAGGGCGTCAGCGGCGCCAACCTCAACACGGCCGT
GACGCTGGCCCACTGCGTGTACGGCCGCCTGCCGTGG