Description :
From Genome Similarity Track
Location :
Scaffold_1:673200- 677550
Transcript NameFunction/comments
Phyin_T30-4PITG_00094Putative uncharacterized protein

Sequence
4350 bases(100 bases per row)
TCAAATTCGAAGCTGATCTGTCGGACTGATACCCGTCCAGCCTGTCATTTCCGTGTCAGCAAGACGGAAGTCTCCATCCATTTCGACGCAATTGCGCACA
GCATACAAAAGTCGTTCGCGGCAGATTTCGTCGCTGGAATATCGTGGGAGTTGGAGTGCGAAGAAACACGTATGCGACTTCGGCATCTGCGAGTCCATCC
AGCCTCCAGGGGGTCCTGACGATGAGCCGTTCGCGTCTCCATTACCCGAAGACGCAAGCGCTTGGATCTTAAATTTCTGGTGGAACTGTGCTGAGCCCAA
AGGCAAACGAGACCGGGCCCACACAAACCGCAGAAAGGCTCGTTTATCCTCCGCTTCGAGACTTTCCAGCACGCGCCAAAATCTCTGAATAAACTCGTCG
TTCATCGACAAATCTTCGTCGTACTCGGTATTAATCTGCAATAGCTTCACGTCCACTTCCGCAACGCCACACATGCGTTTCTCAAGCTCATTCCACGTCA
GAAGAGCCAATGCAGACACCGGCATAATGGAGTGCAGTCCCTGCTTTACTATATTCACCACCTCTTGCGTTTCTTGGATCCGTGCTCGAAGCATAGAATC
TATATATTCTTGCAGATTTTTCAAAGTCACCGCAGTATTGGAGCCATCTTCACAGATATCAACTGTACGTCCATCGGATAATACAGTCGTAAAGACCAAA
TCCATCGCTTCTAGTCGTTCTTCTAGCCCTTCCTGCTTTGAATTTGGACGTTTAAACTCGTCTAAAATACCTTTCAACGTCTTCCATAATGAATACGCGA
CGAAATCGATCTCTTTGAGCGTTGCTAGCGCACTCTCCGGGTTCAAGTCGTCTTCAACCACTAGTTGTTTCCACACTGACATTGCCAGATCGAGACGAAC
GCACACACGCGTGCGTAGACAAATACCGATCATCTGACCGATAAAGAAAAACATTTCACAATAAAGTTGTCGTTTCTCTTCAGCGCTTTCTCCAGATAAA
CACGATACCTTCTTATCATGTATTTGACGCTCGATAAGAGCTCCATTAAGTACGAATTTCTCACGGTTGGCTCCAACGCAATTCCGCCAATTCGGACTAG
GCAGAAGGAAGGGCAAGACACACGCTGATACGGATACATTGGGGTCCACTTTCAGCGACGTACTACTGGGTCCTCCATTCGCAGAATGCTCCGAACTTGT
GGACCCATTATCTTCGCTTTCGGGTACGTTAAGCATCTGTAACTCGGCGAAGAATTGCGAAAAGAACTCTCGATATGGACCACCATAGTCATCCACTCCT
TCGCCCTCGAACTTGACTTTAAAGCTTCGTAATTGACCGTCATCCATTGGGTGGGAGTAGACCATACGTAGCGTTTTAATAGGTAAGAAATGGAGCTCTT
CAAACGACTGGCCAAAGAGGGATGAGAGCAAACTGCTGACTGTTCCTTCGTGACATTTTGCTGCTGCTGCCTTCAGCCGGTTCACGTGTAGCTGCGGTAA
ATCTTCGGGATAATCGTACTCGTCGTCAGATTTTTTGGGAGAATTAGCGGTTTTTTCCATCAACGGCGTCCAAAGTGTGTTTTTTACACAGACAAAGAGA
CTGCCGCGACATTGTGACACTAGTCGACACGGTAATGAGTTGGAATCCGGTAAAAAGTAGTGCCATGAGAGGTCGAAAAAGGGTAAAGCGCGACTGATGT
ACATGTTGCAGAAGCGCAGTATTGCGAGCCGTGCGACGATCATCTTGTCAGGCTGAGGCATCGCAAGTACATTACTAAAGGACGTAAGCTCTAGTACAGC
AGTCTTCTCTTTGACAACATTGAGCAGTTGATTGGGTGTCAGATTCCACGGACTAGTGCGAGATACCTCACAGAAATCGTCAATCACACTTAGAAGCTCA
CGATCCACTGCTACAGTCCACAAATAATGTTCCCCATACTCAACGAGTTCTTCTCGAGAAAGAGTAAAGGGCGAAGATATGTCCACTTTTGAACCCAAAT
GTGGGTCATTTAAAGAGTCTGGTGGGATATTTAAGTTGTCAACTGGAGTAGTGGAACTGGGTGTTGTTGCGCTCGCCACTAAACGTAGTTTGGACGGATG
GAAGAACCACGCTCCAGGTTCATTGTCGACTTCCACCCAGATCCGTCCGCCTGCCACGCCCATTACAACTCCATTCCCACGAGGTGTGCGGACTTTATCA
TCGCAATAAAACCCAGCTTTTTCACATGTTCCTCGCGTAACATCCACCCAGAGGGATTTCCCGGATCGCGTGGTAACGTGTTTAATGGATCCGGCGAGCC
ATCCTGCCGTCATTTCGAACGTAGCAGTAGCCATTTCCACTCGCATGGGACTTTTATCCACCCAGTTGGCCATCAGCTCACAGGCTATTAAACAGTCCTC
CACACCCGCGTCTTCTACCTCTCCAGTCGGAGGTATATTAGTCTCACCGGTACAACTATCCTTAACGAAGGAGATCTTCTGATGTCGCGAGTAAAAGGCC
ACAGCGGGGGACACTGAACCCACAATATTATCGAACGCCACACCCAAATCCACTCCATTTTTACTAAACGAAAGCTCGCCTTTCTCGCAATCCAGCCGTA
ACCCAATGCAATCTCCTTCCGTGAATGTCTCGCCGTATGCTCGTATGCGGTTCCGCTGGTAGTACAGTGCTTTATCGCCAATAAAACCCCAGGATTGATC
GTCCGCTCCAAGGAATGAATCCAAGTTCGCTTGTCGAGTAGCGACCCCTACAAAGAGATACGGAGAACTAGACTTTTCAATACGCACCAGCCATGAATGC
ACGCCAGTCGAGAAGCTCGTGACGGCGCACGCAGCTTTCCATACCTCATTCCCAGAGTACGACACACTGAGGTTGTCGTCTGCGAAGGATAACAAGCTAC
TGCGAGTGCGTTTGCGGTCATACAGCAGCAAACAACCTTCCGATTCCGACGCATCTCCACTGCTACTAGCGACCATATGAGCGGCAGGTGTTGGGGCCAC
GTTAAACCCAGTAACGCCCTGTAGAACGTGCAGCAGTTCCACGTACCCCTGGAGATACTGAGAGAATAACAGTCGACCTTGACTCAACTCGCGACTGTGT
CTTACAACAGCTGCAGTTAAGAAGTCTTGGACGACCAGTTGTGCCTCGTTTACCATGTCTTTGTCGACATTTTCTATGGCTCTCAATACTCTGCTGATAG
TGCGAAGGATGACAAACTTCAGCGGCAAATTCGTCGTGCCAAGACAACGTCGTAGACGGCGTAAAATAATCTTCGCAGCATCAACAGAAAGACACAATGA
CGAGTGTGTAGAAGCTGCTAGTAGCGCGTCTAGCAGCCAAATAACAATTTCAATTCCTGGCTCTTCCAGCACAATTTGATCTGGACGATGGAGCTCCCGT
TGCGTCCATAAAACAGCTTCGTACGCTTTACCAGCTGCTGCTGTTTCCAGTTCTTCAAGGCAGAATTCGAACGCTGACGCAACGAAAGCTGCGTCGTGCT
GGATCAAATATCGAATCGACTTTGAAAATACTTCATCAATAGATAATTTTTGCAACTGTGTCGACGAATTTCGCACAATAATTGCGAATTGATCCCCACG
TAATCCAGCGAGTTTTAGCAGCTTGAACCACTGTTTAAACGGTATCAAAACCGGTACTGACCTTGTCTGATGTAACACTGTGGACATAATCTGACGAGCG
TACAGGATTGACAACGTGTTCTCGAATTCTCGCAGCTGGCGGACCAGATCTTGAAGGTCAAGTTGGTTCAATTCTCTCTTCACTTTCGTTTCTATGGCGT
CAGCTCGCCATGATTTCATAAAACGCGACTTGGTATTCGACAAGAAACCTCCATCTTCGAAAGGAAAATACATTTCCGCAAACAATTTTCTCCCCATTTC
TTTGTCATTTAAATGAGGGACATCCATATCGTTCTCGGCGTCCTCTGTCATGTTAACAGTCGCACTTAATGACGGAACGTGCGTACTACCGCTCGGTATA
TCGTCAGTATTCACGACGTCGTCCTCTTCTTCGTCGAAACGAGGAGAATCTCGTCCCTTATCGCGTTCTTTATCCAATGTGGACTGTAACTTACTCAGAT
ATTCCAGATTGTCCACAATCCAAGCCGACGCATTGACGATATCGTTCTCGGTTTGCTTTAACGCCAGCACGCACCAATCTTCCGGAAACCCCATCAGCAT
CAGCTCCTCCACGAACTCCGCTCTATTTTCTTCAGCGTCGTCTTCGTCGTCGTCATTCTCTCCATCGTCTAAACTCTCGTCTTCCTCGTCGTCTTCGTCG
TCATCTTGCTCGTCACCTTCCCAGTTCTCATTTACCGGTTCGTCTCCATC