Description :
From Genome Similarity Track
Location :
Scaffold_863:6732- 10519
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_863-snap-gene-0.1Calmodulin 5

Sequence
3787 bases(100 bases per row)
CAGGGTCGGCCGCGGGCCGGGAGATGCAGGCTGGAAAGTCGGCGGATTGTCGGTGGAATGTGGCTCAGACGCCAGCAGGTATCGTGGCACAGTGTCGGAG
AGATAGCCCTCTCGCTATAATAGATGCGCTCATTAAACAACACGGACCTGGGGATCGGGTGGCCAAACCTTTGTGTTTGTCGGACTGCAAATTGCGCTTT
AGTAGGCGCCCATGTCCCAGAGGATGGGAAAAACGTAGCAGTTGTAGAGTTGTAGAACCGGACGCGCTTGCGACTTGCGGACTTCGCCAAGGGAAACCAG
AGCTTGCGAAGCGCCATGATTGCGAGATCGGAGGGGGATGGTCTCGAAAATCCAACATTCCAGTCGAGTCCTAAAAAAAACGGTTGTTGAAGTTGGATTA
CTTCCACGAACAACAGAAGCACGTATTAAAATGTGTACCGTACTATTTATTCACGCGCATATCGCAAACCACCAGACGCATACATATAGGACGGCCATGA
CCGCGGATGACGCGGTCCAGGAGTGTACACAGCTTGGCTGAATACGGAACCTTGACCTCTGATACGCCCCTATTTCAGTATGTTAACTCCTACCGTGAGA
GCTTTCAGCTCACACCTCCAATGAGTTAGAGGAGAGAAAAGAGAGGGAGAAGCTTTGCTTGCGGAGCCTCCTCAAGTGGGTCCCTCAGAGGGAATCGGTG
GGCTCTGTACACGAGCCGATGCTCACACGAAGTGGTGTGGCTCACTCCAGACTAAGGCAGTAGTGTTGCCCCTTCCGCACAAGGGCGCGAGCAAGGCGAG
ACTGAGGTGAACCACACATGCTTCCTCCCGTGCATAAACAGGAAGTGATCTGGACCTCTACAGCAAGCCAAGCACAGTGTACTCCTGTAGGATCCGTGAG
CTCGTATTGCTGGCGCCCAGGCGTGTGCATATCCTTGTCAGCCACGAAGCCACTGACGACGCCAGGCTCTTGAGTCGTCAGTATCTTCTTGGATGAGGCC
GGGCTCAGTATAATACTGTACCAGCCCCAACTCGCACTTGAACACTGCGGATACGATATTGAGCTCATGCCCATACGGTAGTGGTCTACTACGTGGAAGC
AGCCTCCATGAGCTTGACAAACTCGTCAAACTCCAGCACGTTGTCGCCGTTCTTGTCACACTCTTGGTAGAACCGGTCGATATCTTCCTTCGTGAGACCG
CCAGCCTGGGCACGCTCGAGGCGTCGCGTGTTCTCAGCCCAAGCGCCCCGCGAGGTCTCGAGCGCCGGGGCGAACAGCTCTCTGTCGATCTCAAGCGCCT
CGAATAGCTCGTCGCGGTTGATCAGACCGTCGCCATTGCGGTCAAACACTCTGAAGATCTCCATCAACTCTTTTCGCCGTTCTTCCTGCTCGTCGTCGGA
AGCCTTGTCGCGGTCGACGTGGCGCGACGAGGGCCGCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTCGTGCAAGTCGCCAACCTT
GGCGAGCGTGAGCATGGCCTGCAGTTGGTGTTCGTTGGCGTGGCGGAAGCAAACCCGCAATAACTCACTCAGCGAGACCGAGCCATTCCCATCCACGTCG
AGTTCCCTGAAGACTGCGTCGAGATCGTTGCGGCCGAGCTGCGTGAAGAAGTCTCGATGTAAAGAAAGCTCGTCGCGAGTGATACCACCCGAACGGTCGA
CGTCGAGAAACCAAAAGAGCCGAACTACGGCCATGACTTCACGAATGCTGTAGATGCCAAACATCTGCTTGCGGCGCATCGCGATCGAGCTGCTGCTACG
CGTGAGGAGACGCCGTGTGGATGCGTGCGTGCCATTGGCCTGTTCGAACGACACGAGCGAGATGCGTCGGAGCTGCTTGTCGAGACTGATGGTGGCCGTG
CCACCATTTGGGGACGCCGAAGTGATTACACGTGGCTTGTTGTTGGCCGCGTCCACGAAATCCATGACGCGAGCATTGTTTAGAGATCGTTGCGATTCCT
GCGTGACTGGTAATGGTGATAGGACGGGAGACTGGAGTGATGATGGTGGCGACGCGCGTGCTGCTGTTTCGGGGGCCGTGATAAGGTATCGCCTGGACAG
TCGATGAGGGGACGGTGCAGTTCGGTTGTCTTTATCAGGCGAGGGTGTCGTGGCCTTAACGCCGCCTTGCTGTATGGTCTCGTGTTGCAATGCCTTGTTC
TGCCTCATCAAATACAAGACTTTTCGACGAGATGGAGACGGGGTCGCGGCACGAACACGTTGATCGTGCTCTATCCCCGCTGTGAAAAATTCTCCATCCA
CGGTTAGCGGGTCGAGTATCGCAGCCTTCACTCCGACAGTTCCTTGGTCATCTGCGCGAGCTATGATATGATCTATGGTATCGAGCTTCCGCAGCAGGCT
GGGAGACAATCGCGGAGGAGAGCTGCCGCTCTCCATGGTCGCTTCAGTGGCACAATTAATCCGAACACTTCTGGAGGCGGTGGTCGCTCGCGTGGTCTCG
TCGTTCGGAGAGGATAAGCGATGGAAAGTGTGTTCGATGTCTTGAGACGGACTGAACTCCGCTCGCCTCCTGCGTTTCCCACCGGCAGTCCGACTCACTC
GCACTGGTGATCCGTCGTCAAACGAAGCGACCGCACATTCGCCATGACTGTAGGAAAGGGCGGGGACACGATTTTGCCGGCGCGACGGAGATTGAGGATA
TGTTTGTGTCGGCGACGGATCTTGCGATTTGAGTCGATCGGAAGGCACGCCCCCGTGAAACGTTGTAGTGCGGTACTTGAGACTGGATTTTGCCTGCGCG
AGTTCGAGGTTCGGGTAGAGGCTCCCGAGCATGCTTGTGTGTTCCCGGTCCAAGTGTGGTCTGGCTGGCTGTGGCAAAATACCGCTGAGATTGCATTCCA
CGAGATTTGGGTCATCTCGCCAGCGCCTGGGCGAGGTAGCATGCACATGGGTATCAGGACACTAGCAATCTCAGTTATGTATGGCGTTGTGTATATTTAG
CGTTCTCTGTGTGCCTGTGTGTGGCACAATTGGTGGTGCGTAGCTCTAGCTGCCAAACAAGGGATGGCGATGACGGATGCCAAACATAGCCTCTTGTTTT
CATTTGCTAATTGAATATGGGGAGTCGAACGAAAGTTCGTGACCTCGACCTGTTGGTCGCGCTGGACCGCGATCTCATGAGTGACTGCGTCGGGAGCATA
ACGTATCGACAGGGCCCGGGTCACCGTAATCTACTGAGAGACATATCATACTGGAGAATGATTTGTCTCTTTGGTGCTGCATCTTTTATGTACATGTAGA
TGGCTGCAGCTTGGATGTAATTACGCTTTATCAGTACATAAGTATCCTGCAACACGAGTTGTTTCGGCCTGAAGGGCCTCAACTTCCAAGGGCTCCGCAT
CCTCAAGAACCCCAACATCCTGTTGCTGGACGAGGCTACGAGTGCACTATACGGAGAGCGCTGAAGATCGTACAGGAGGCGCTGGTCAAGGTCGTGGCAC
TGAGGCGTCGCACGTCGATCATCACTGCCCACCGCCTATCGACCATCCGCAAGGCTGACAAGATCTGCGTTGTCAGTGGCGGCAGAATTACAGCTGTTTG
GCATTGAAGGCCCAGATCTTTATATTAGTGCATATGTCTGTGATTCTTCATTTGAATGACGTGTATGTACTGCTTTAAGGATTTTGCGAGTTACGTGAGC
GAAGATCGGCATAATCATTCCCCTTGCCCTATTCTGGAGTATGATAAATCGCGCGATGATTGCTGCCAAGGGCGAGTGTGTGAAGCG