Description :
From Genome Similarity Track
Location :
Scaffold_584:6731- 9756
Transcript NameFunction/comments
Phypl_g9595hypothetical protein

Sequence
3025 bases(100 bases per row)
TCTTCTCAGGATCCGCTTGATAGTATTTCGCAGGAACCACGACTGACTGTCCGGGCTGAAGGAAAACAGCCTCACGTAGAGTCACACCCAGCTCCAATCC
GACATGATCGATCTCAGGACCACCAACTAACAGGAGGGATTCCTCGTCCGGCATACGGACAACGCCTTCTCGGGCACAGATCCGAACGCCTGCATCGACC
ATGAAATCCACCCCCAGACGGCAATCCATTCCTTCACCGATGTTCCCAACCCAGCTGTTCATAACATAAACCACAGGTCAGCATAATCCGAGCTTGAGCG
GTAACGTACGTCGGGGCATCGCCATATCCAGTGACTCGAAATCTGAAACCGTGACGGAGCTTGAGTTTAATCTGCGTGCAAGATCTAAACTCATTACGGT
CGTCGTAGCTCTGGTGTCCATCAGCACCTGGATGCGATAATTAAAAATCGCTCCGTGAACCATCGCCATAGCACGGTTTTCTCCAGTCAACATGTGGTCA
CTCCACCAACCATATCGTTCGCCTCGGGTTAACGCGAATTCAAGATGGTTCTCAAActcttcgctgtcgctgggATGGTCGAGGTCGGTATTAAAGGCGT
AAACATAGCCATCAACAATCGATGACGTACATTTGGGGTTATCTTCGTGCCAACATGGAAGGGCTGGGCCCATATATGCAAAGGCACAAAGCGCTTGGGA
CTTTGGCTCGTCACGCACTGGTTACCTAACCAGCAAGCCTAGTGATTTAACGGCTTCAGGGGCTCTGGGCCGTCCAGCAGATACTGGACAACATCAGCGT
CGAGACCCCAAGGGAACCTCCAGCACGGAGAATCTCACGTACCGCCTTCAGCGCGGACCACATGTCATACAAACCTGGGCGATAGAAATCGCCACACTTG
GAACACGGTTGACGCTGGTAGAATTGGGTCAGATGACCTTCTTCGAAACAGCGTCCACAAATGAGCTTGCTCTAGCACTTTTCAGTGAGTGGCTAGTACG
GCCACATTCTTCGCATGGTTTCTCGTAGTGCTGAGCTCCCCATTGTGGTTTGGTTGGGCATCACGTCTGGGCCGGAACGCTTGTCGATCAGCTAGACGAA
AGTCGCATCGTCAATCACTGACGCCAGGCGAGCGGGATCAATCTGAGCCGGGTCGGACGTTAGAGTAGTCGTAGTTAATTCCTGGACCCTGGGAGATTCG
GCTGGGACCTCTTTCTTAGCTTCAGTGTCAGCGTCGTAGTCTGAGCCGAGATTGCCTTGTTGGTTGGTATCCCATCCAGCTTGAAGGATCGGCCTTCGAA
TTGATGCTGTTGAGGCTTGAAGCGGCCAAACTGCCAACGCGGAGTAGGGCGCTGCTTTGGTTAACACTCTCGAGTCTCACTTTGACGCAGAGCCTCCACT
CGGTTCAGCATTTTTCTCCAAATCAGTCATCGCACCAAAACTCTGTCCTTGGAGACTCGTCTTCAGACGCGGATCGCCCAGTGCCGCATTGAAATGACGT
ATGTGAGCTTCTCGTGCCGAGATTGACTCCAGAAAGTTGACCTTGGCTTTCTTCGCAGCACGATTCAGCTGGTAGAGGAACAGCCGAGGTGGTTCCTTGT
CTCGAACCTTCATGGAGTAATACCGCTCAGGCCATCGGCCAACAGCACGGCACCATCCCTTCTTGAAGACATGAGATAGCTTATTCCGGTCTGGGCGAAC
GTCATCCGAGAGCTGGGTAAACCATTCTGATAGTCGCATGCGCAGCTGGACAACTCGGGTCTTTCATTCCAAGGTGCCATCGTAGCATAGTGCATGAATC
TCTCTCACCAGTTGACGCGCTCTTCCAGAAGGGCCTGTTCGTTGAACTTCTTCAAGGCATCATGAGGAATCATCGCCTGGACAACTACCTTCGCCCCAGA
CCCAGAGTTGACACCTTTCGGTTGAGTGACGGCTCCAAACTGTCCTTCGAGCTCATCCTGCGACGAATCACTAGAACTCGAATTCCCTGAGTCTGAGTCG
CCCCCGTCCGAGTCACCAGGCTTGCAGGTCCGGGACTTGGAGCGCTTCGTCTGCTTTGAAGATGTAGACTTACTCTTGGATCCAGATCCGGCTGATATGA
ACTTTTGGGCTTCTCGGACTGTTGGGTCGAGTCCGTGGTCTCCGGATTCTGggcttgtccagcgtgtACCAGTCATTCAACAACAGGTGCCAGCTGTACC
ACTTGCGCAGCGAGAGGGTCTGTCGGAGCGGCAGCCTTAAACTCAGGTGGCTTCACTCGTAGTGGGGGCTGAGCTACCGATCGGGGCGTTGGCTGGTGTC
TGAGGACCGAAGTATGGTATAGCTGTTCTTGAGCTGTCAACAAGCGGCGAAGCTTCTCTTCATGCACTTCCACCTCCTTCTGGCTCTCAGCTTGGACTCG
CGCTTGACGCTCCTTGCACTTCCGAAGTTCAGCTTCGTGCTCAGCACGAATGCGAGCCACACGCTCGTCATCGGACTTCCTTCGCTCAGCGTCCAGAGCT
CGGATCTCAGCTTCGCTTCTTGGACACCGAAACGATACTAAGCTCGAACTCGGTTTGCTTCGCGCttttcagcttcttcagcagccaGCTTCTGAGTGAT
TATCTCTAGAGCTTCCAACGCCAGTTGCTGATCCGACGTAGCTCGAGCCGATGCTGGTACGGCAGCTGCCACAGATGTACCTGCTGGCGGCTGGTCACTG
TGGATCACGGCGGGTTGAGTTAATATAGCAGTTCTCCTGGACGTCAACTCAGATTCAAGTTCACGGATCCGAGCTCGCTCGGCATGGATCTGAGCCCAAG
CGTCAGATctgagctgctccacctcacGGCGGTGCTGTTGTGCCAACTGGATCTCAGAAACTGGGCGGTGGGGCCGTCTGATGAAAATCAAAGGTCCCGA
ATCCAGCAAAAGTGTCACGACTACCGTGTTCACTCGAGAGAGCTGAAGGAAAGATCTCTTCGTCACGGCCACTTAGAGCAGCCTTCTCGGATTCCGAAGT
ACTGGATAACGGCACTCGAGATGGA