Description :
From Genome Similarity Track
Location :
Scaffold_107:67300- 68312
Sequence
1012 bases(100 bases per row)
GNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTAAAGCCCCAGCAGCAGAGAGCGGAGTTTCGTTCTCGCCGCGCGAACGC
TTCGAGCTCGAAGCGTCCGAGTCGTCTCCTTCACGAGGGCGTCTCGACCCGGCATGCGGGTCGAGACTATCGCTGTCGATTGACTCCTTGCGCTTGCTAG
AAGAGGCCTCGCCCTCTTCCATCTCCACGTCGCCGTCCTCGAAGTCAACGGCGTCGTTGACTACAGAGGAACCTTCGAGGACAATCTCCGGTTGAGTTGT
CCCCGCCGCAGCCTTGGCAGCTAGAGCGTCACGCTTTGCTTTGTGACGCTCGAGGTACTCGGGGATAGAGAGAGTCTCTATCCCGGCGGAGGTATTCCCC
TCTGCTTCAGCGGCGGTCTTCTTCTGAGGCGAGCTCATTGCGGAATGAGCTCGAGTTTTCTTTCTCCCAACGTGAAGAATTGACGAATGGTCAATTTCCT
GATTGACGTGCCGTGACTCGGCGCGACTAACCTTGAGGGGGGTGGTGGTGGTGTAACAGGGTTACACGCACAAGTGGCTACAGTCACTTGTAACTCTAAC
AGACACGACGTCTGTTAGAGGTTCGAAAGACTTTCTCGACCTTGGTGTAGACACACCAAAGGCTACATACATTTACGACCACCACAACGGGTGGTCCATA
GAGACTTAGGATTCCTATCGGCTGAGAGCAGCATCTTTTAGCCAATGAGCGACATGCATAGCATTGGAATTCTGCCAATCAGCCGTTGGCAGATTCCTAT
CTTAGAATATCACATTTAGAGGAAGTCAGAAACATAAAACAAAAATGGCAGTTCTCATTTTAACCCAAAACATTATTTGGATCGTTTATTTAAATTAATC
TATACTCGGAGGCCCGAGTATAATTAACTCTAATTTAAACTAAGCTACGCTTCCTCACATACACGCGCACACGTGTAAGCTAAAGTAGTGAGCCAAAGTA
GGCCCATTACAC