Description :
From Genome Similarity Track
Location :
Scaffold_25:673- 28754
Transcript NameFunction/comments
Phyag_g686conserved hypothetical protein
Phyag_g687condensin-2 complex subunit D3, putative
Phyag_g688hypothetical protein PHYSODRAFT_257507
Phyag_g689hypothetical protein PHYSODRAFT_475541
Phyag_g690hypothetical protein PHYSODRAFT_476751
Phyag_g691hypothetical protein PHYSODRAFT_390137
Phyag_g692hypothetical protein PHYSODRAFT_320777
Phyag_g693hypothetical protein PHYSODRAFT_553683
Phyag_g694hypothetical protein
Phyag_g695conserved hypothetical protein
Phyag_g696transport protein particle component, Bet3
Phyag_g697conserved hypothetical protein
Phyag_g698conserved hypothetical protein
Phyag_g699hypothetical protein PHYSODRAFT_467172

Sequence
28081 bases(100 bases per row)
TGGAGACGGACCTGGgcgtcgacgccaacgccCCCGTGGGCAACCAGCAgaagccgccgcagcagcagcagatcaaggagcagaagcccaaggccaagaa
gcccaaggccCCCAAGCCCACCAAGGCCCCtgccgccgacgccaacCAGCCCGAGATCACCAAGCTGGACATCCGCGTGGGGAAGATCGTCAAGGTCTGG
AAGCACGAGACGGCGGACAAGCTCTACTgcgaggagatcgacgtggGCGAGGACGCGCCTCGGCAGATCGCCAGCGGACTGGTGCACCACTActcgctgg
agcagatgcaggaCCATcgcgtgctggtgctgtgcaaCCTCAAGCCGCGCAACCTCGTGGGCTTCCGCAGCCACGGAATGGTCATGTGCGCTGCGGTGCC
TCTAGAGGACGGGAAGGAGAGGGTGGCGTTCGTCACGCCTCCCGAGGGGGCCGAGATTGGCGAACGCATCACGTTCGAAGGCCTGGCTGGAGAGCCGTTC
TCCCCTGCccaggtggagaagaagaaggtgctgacggtgctgggcgacgacatgaagacggacgacgagggaGTTGCCAAGTGGAAGGAGCACGTGTTCG
GAACGTCGGCGGGGCCCTGCACGGCGCCTGTGAACAACGGCGTCATTAGAtaagcagcaccaggtcgtGATGAACTGGAGAACGGTAACTTCAGCAGCGA
ACACTTTACTTGGCAAGGAACTATCTAGTTGCGTTTGCGCTTGGATCGAGTACTTGCAGCCGCGACGGGTTtcttggtcgtcttcttcttcgtcttcttc
ttgattGGAAGCGGCACGACAtcctcttcctgctcgtcgtttTTATCTCggtgctcttcctcctcctcctgtgtTACTGCAGTCTTGGAGCTCTTTTTTG
TTTTGGCCTTTGCTCTCGCTTTGGCCTGAGCTCTGCGTCGAGAGGTGTTCACTGTTGACGGCACTacctcgtcttcgtcggaaTCGTCTGCCGAGtcgaa
tgcagcagcgaggtccttcttcatccgccCTTCCAGGTCTTCCTGCGTGAAGGCCTTCTTATCACGACCTTGAGGCTTATCTACAGAAGGCGACTTGGCC
GTCACGTGCCAGTTCTCGTTGGCTGGATGACCCTGGCTGGGGGAGAAGATCAACGTCGAGATCTCGGACGTCTGTCGACGAGCTTCCTCGCTGGACACCT
CACGCGGTCGAACTCCACTGCGAGTAGGTGTCGGTGTTGCCGGCAGACTctgacgtcgtcgactgcCATTAGAGGTGCCCTTCTCATCGGTGCGAAAGCG
TACAGGGGTATGACTTGCTTCCAACAACTCCTCCTGCGGCGTCTGTGGAGCTCGGGCAGCAGTTGCTTGCGGGGACATCGGCGCTGTTTGAGCTTCAGTC
GGTGCGTAGGTATTGCGGCGAGACTgttgtttctgctgctgttgctgcaggtcgtACTGGCGCAGATCGTACTCTACTTCCATTGCCATTTGTGGATCCG
TGTTCATAAAGATGTCCTTGACTTCTTGGCGGTACATCTTAAACAATTCACGAATATAGTGGAGCAAGTAGCGAGTCAACGGGCTGTGCTTCGACTCGAG
CGTGTGCTTAAGACCAATCAGTACGGGCACGACGTTCTCCAGGAAATTCTTCTTGGACATCTTGGAGAGAAGTTTGCccttcgctgctgcgatTTGTGAC
gcgacgttggcgttggtctcaggtgctgcatcttcaccctcggcatcgtcgtcatcctcttTCGAAGTTGTCAACTTGATTTCTGGGGAGCACAGAATAG
CGAAAGTATCTTTGAGAACCGCCTCCGTGCAGCGATCCGTGATTTGCGATGGATTATCGCACAGCGGCAGTGTGCCATCCATGACTTCCTCTAGTACTTC
AGTGCAGAGCTTCATGGAAATCTGCAACTTCTGCTCGTCCGTCATGTTTTCCAACAAAAAGGTGTACAGCTTTGCCCGTCGTGAGTAAAGCGcgttgccc
agcagcgcgagtTCACGAGTACCTTCCTCCTCAAATGGTTCTGAGAACTTGATTTTGTTGCCCTGAATCCCAGTGAAGACAAAGATCATCTCGATGAACT
TGTTCGTGAAGATGTGCGGCGATTTTTGCAGCAGGGGTCCACAAAGTACATGGCGAGCCAGGTTTGcaagctcctcgtcctcatccaccGCTGCGCGAAG
GAAGAATCGTAGCAGAGACTCGCGCCACTTGATGTAGTCCTGCAGGATTAGTTGCGAGAACAGGAGCAGCGCACTGCGGCGTAACAAACGGCtctcatcc
agcagcgacagcgcaaCAGTAGGAATGTACGCATCCACGATAGACGTGTAGCGAATGCAAAGATCGCCCAGAATCAGCAGGATGTTCGAGCGAATGTCCT
GCTCTTCGCAGGTTCGCAGCTCACGAATGAACATGGTCATGCACTTCTTGGCGAGGTCATTATCGCGCAAGCACAGCTTGCCGAGAGTCACGAAGGCGCA
CACACGTACAGGAGTCGGCAACGGAACGGGCTCTGACCTTATAGAagtcgtctcctcctcgtcgtcttgtcctgcagAGGACTGGTTGATGGCATTGCTG
TTGGGGACGAACTTCGGAGGCAAAAAGAGCTGCACGAGAGATTTCAAACTGGAACTAACGGGTAGGAGGGCAGCTTCGCTACTCTTGTCAGCATCCTtgt
cgaactcgagcagcgctaCTTCGCCGATAGAgatgagctgcttctgcaatAGCGCCGTTTCTTCCTCCACGCTATCCGGGCTGCTCTCGAAGCATTTACG
AAGATTGGTCTCGCAAAGCTCAAGAAGTTTTTGTCCCCACGCAAAGCTGATGTCACGGCTCTTCTCGGGCGAAGGAGCCTTGGCCTTGCAAATGCTGTTC
AACGCGAGAATTCCATCGGTAATTACGTTCAGCGGGATGGCGAACGAATGCAATGACGCTAGGATGCCGTCCGCAATCGACTTGGCATCTTGAGCATCAA
TCACGGTAGAAATCGCGGCAATCACACGCAAAATGCGCTTCGATCCGTCGTTGAATTCCACCGGTAATGCCTGGTCCTGCAGTTTGTTCCAGCACTCGAC
AACTATGCCCAGGTTCTGCTGCTTACCCCTCACCGCCTCAATAAGATTTCCTGAGTGTGCAAGCTCTTCCAAAACAACCCAGCTGAAGCCCCAGTAGCGC
GTCAAAACTCGACGGACGGAGTCATCTTcggtttcttcttgcacCTCATCCCCGGAGCTGTACGGGCTTACGCTTTCCTTAATGGCGAAAACGCACGCTT
TGATAATTTTCTCGACGTTGATCTTGTCACTCTTGATTAGCATACGTAGTGCCTTCTGCAAGCAACGAGCCATAACACCATCAAGGTGCGATACCTGCAT
CCAGACGCAGTCGAGAGTCTCCCGTTGGGATTTATTTCGACGCGCATCATACCACGTCAGAATTCGGTCAAAGACAGCTctgcctgctgcttccagaGCG
CAAGATTGTACGCTCGTTTCAGGATCAACACACAGCGGGAGAACTCCAAGATTCCACACTTTTTGAGCCTCTTCATCACGCGGGAATTTGAGTAAGATTG
CTGATAACGACTTGATCGACTGCACGCGAACAACAACCGAAGAGTCTGTGCAACGTGCGTGGATATCAAACAGGTCTTTccgagaagaagcgtgaACTGT
GGCACCAGAGTGAGCTGTCAAAAGAGCTTCTAGAGCGTGTACCGCAGCTCGGCGCACGAATGTTTTGTCATCCACCAGTCGCTCACGGAAGAGTTCAATT
AGTTGCTGCATCAATGGTGTTTCCTCTAGCGTCTTAGCTCCATCAGCATCAATTGACTGCTCATATAAAAGTTTCTGCAGAGAGCTCGCAATCGCTTCCG
ATCCGCTGCCGCCGTTCATTTGCTCGTCATTGTCATCGTCACCGTTAGCCAGGTTAGATAAACCAAGCGTTAGCATGGCCGAGATACCTGCAATTGCCTT
CGTACGAACTTGGGACATCTTGTCGCGAGCACGGTCAATAAGGACCTCCAAAAGTGGACCTACACCTGAGTACGCGACTAGCGTTTCgggcagctcgttc
tccttcaccttccAGAACCTGGACTCCACGACAAAACGACTAAGGAGCTCTACTGCGAACTGGCGGTACTTCAGTTTGTCGTTGCGGGAATAACTAGCCA
AAAATCGCGCGAATCTCACACACTCCTCATCTCGGAACTCGCTGGGTCTTTCATTCTCCTCCAATTCGCTCTCCCGTCTCCCAGCCATAGCAGTCGAGAA
AACGTATGAGATGACACGTTGCCGTTCGTCCGCACGACCCGGCGCCTGCAGACAAATGTTTTGCATCAaccccagcagcatcaatgaGTGGTCCTGTCTT
GCAGTCCCCTCTGCATCATCCTCTTCGCACGCTTTCGCTGCAACCTGCTGAATGCTAGTAATAACATCAATAGCGAGTTTGTGGAAGCGCAAGGCCGACC
GattctccttggccaccgtCTCCTGGAACGTCACTCCAGGGATGTAGCAGTGGAAGATCACGCGTCCAATCTGCAATGGCTCACCATGCGTTCCACTCAC
CAAttcctccagcatctgcaaCGTCTTATTCGTCATAGCTGACGCCGTGCCTTCATTCTCCGGTGGCACCGCCGTCTGCAACGCAATCACCGTCTCAATT
GTCGGCACAATGGACTCCTTACTCGCCGACAGCGAGAAACTATCTAGAAACAGCACCAACATGTCCATCAACTCCAATCCACacgtcgccagcatctcga
gcGTGACACCAGAACCCTCCTCGCTCTCATCTTCACtgtcctgctgcttcctgcgtcttccacgtcgtcctGTAGTTTCCCTCTGCCCTGAATTTGTATT
GCTACTGCCCTGATCTTTCGCAGCCATGAGCACTACCCACTTCTTCagcgtgtccagcacctgACGATACACGTACGACATGAATAACCCATAGGCCGAT
CCCCcaggcagctgcagccaggCCAGATAGATCTTAGCAGCTATTAGCGCTTTCAGCAGAGCACTGCGCTTCTCCGTGTCGCTCATGTTGGCGTAAACGT
CGCGTACGTTCACAaccgcctgcagcagcgtgaagagcGAGCGATAGACCGCCTCCTGGTTTTCGTTTccttcctgctgcgtcacCACTGCGTCGATGGC
CTCCTGAGATGCGAAGAAGCTCCAGAGACGCGCCACCTGCTCGTCTGTAGCTTCtagacgagctgcagcctcctgACGACGCAGATATTTGGCCAAGACG
CGGTCCAGAGCGCGAAGCTGGCGACGCGAGACGTTGTCGCACCATTCCTcgcgcacagcagcagtgccgcCAGTGTCGAAGAGGCACGCGACGGCGCTCT
CGGGCACAGAGCCCAGCGCCAGAGGCTGCAGGAcgcgcaccagctcctgctcgagcTCCATTTTTGAATAAATTTTTGGCGGGCTTTGCTCATAAAGGAG
TATTGATATACGTTAAAGAGATAATAGCCAATCAAAAACGATTttcttcacttcaacgtggctgCCCAATGGCAGGAGCTCTAAGAGCCGCAGCGGAACT
CGGCAAATGTGGAGAAGAGCGATAGCTGTTTGACAGGTGGTAGTGCTACAAAGCGAGCGGTGAGGTCTTCTGCGTCAGCGAATTCCCCTCTGCGAACGTG
GATGTTGGCCACCGACTCGATGAGATCTGAGACAGAGAGTTTGTGAACATCCCAGCACAAAGAGGCTGGAGATACAAGATACAAACGCTCTTACATGGAt
ctgttggcgctgcagcaagcagctctttCAGTAATTTGAAGCGTAGATCTGTCAGACTACAAGGTACAACTACCAGGTCAGCAGCGTAGAGTATTACACC
GATAGCAATGGTGCCGACGTACTGCCCCAGACTGTTGGTGTTTCGCATAGCGAACGTGATATCATCGACGCTTGCGAGCGTTGGGTTTTCGATGTATTCC
TGCTCACGCAGAATTCTGCCAATAGTGTCAGCCACAAGTGCGCTTTAGAGCAAGTGTCTATACCAACCTGTCAACGTAAGCAAGGTCCTTCAGCCGGTCC
TCTGGAAGCGCGAGCGCTATGAACTTAGAAAGCAAGTCTGTAACAAAGCGCGAATTAGACATTGTCGTTTCGACCATGAAAGTTTCGTAATCACAAGGAG
CGCGCTGtacctgcagcttcttggcgctgcttaCGCTGCAACGCTCGCGAGAACAAATAGTGCAGCGCCGCTCTTCGCTTTAGAAAGCGTTGACCAGCGA
TGTTGGTACGCAGCAATGACAATTTTTTGCGAATACAATTGCGTACCCGTAAtcgctgcttctccaagacgtcgtccagctcctctgGTGGTATTCttgc
cagctccttctccttcatcatccGGCACGCGGCGTCATAGTTCTCCAGACACCGCTCCGTATCGTGGAGTCGGTCCCAGAGGCGAGCAAGCTGTGAGAGA
GTGCAACAGCGAGCGATACTTCATCTCAGCAAGCATGGGACCAGCACGGATCAATCCAACGTCAGACTCACCTTCAAGTTGGCCCCATAAGGGTCCAGCA
TCGTTTGTCGCTCCTGCTTCACCGCTCGGATCTGgtccatgagctgctggaattcTGTCGCTGAGACCTTATCAGCACGTCGACTTGGCTTCTTCCCATt
cggcaccaccacgtccggCAACGACACAATTCCAGCCGGAGTAGCTGCGCGAGTGACATTTCCCGAGTACGAAGAGCTCCCTGGTCGCACCTCCTGAGGC
GCCGAAGCTTCCAGCTGCACCAAATGCTGGCGCAACACAGCCACCGCCTTATCACGCGCCGCCTTGGcccgttgcagcttctcgtgaCGCTCCTTCCTAC
AAAAGAGTTAGCTAAGTATATCACGACTAGCAAGAACAGCCACCCACAACACGCACTTGTCCTGGATAGCTGGcagtctcttcttctcggcctggTAGCG
ATCCTGCAGCGCTCGGATCTGCGCCAGCACCGCAGCGCGCTGGTTGTAGACATTGGCGTTCTCTAAAGATTGCGGCATTGAATGCGATGCGTGTCAGCAC
CCCCGAGTTTGATTTGCGAAGAAGCGTCTGCACCTGCGTGGAGAGCGAGTTTGGTGCCGTCGCGACTGTCGAGTTGCATGAGCCTCACCAAGCTCCTCGT
GCGGTCTCGCTGGGCGTCGCGACGCGCGGCctcctggcgctggagctgctggatttCATCGTTCCGGCGCCGCAGCTCGGCGGCAATCTCGGACCGgtac
gttgaagttgctgccacgCACGACTCGTCGCTCATCCCCCTTCAAAATGCGGCCGTGAAAGGTCGCGGCCCAATTGAACCAGGCCAAAGATCTCGCAGGT
GGAAATAGTCTATGGATCGCATTGCAatggacagcagcaagaagcagagagagagagagagagagagcgcGCGCGCATCAAGCCCATGTCTGGCGTATAT
ATGAGCgctgtggtgttggtggtcTGGTGCGCTGATAACGCGCGACTGGCTTCCTGCATGTCGTCGCACTTAATTGAACTTCAAGGTCTCCGAGTGACGT
CGTTTCTAGGCCGCCCGCAGGAtcgcatacaaagcgcaagtCATTTTGCGCGCACGTACACCATGCGTGTCTGCGTAGCCAATCAGCAGGCGCCGGGATC
TTTTCAGTAGCTTGGGGCGCCACTAAAGGCAGGTGTTCTCGCAGTGTCTGCGCTTGTGCGCTTGTGCGTCGCACGTCCTTAAGTCCAGGTACCCCGCTGG
CTTCGAAAAAAAGCCCGTCCAGTCCACTTCCTACGTCAGCAGAGCCCACAACAGCATTTGCCTCCAACGCCACTCAAAGCCACAGCCAGCGTCCGCCAGC
GCAGAGCCAGGCACCGCACAGCGCCCGCGAGCGCAACGAGTGAACGTCAGCAACAGACGGCGAGAACACACAGCTCCAACCAGCCAGCCAGTCACCAAGT
AACGCCCCACCCGACAAGCCACGGAAAAGCAACAGCCGCCGTCCCAGCCAGCCTCCCATTGCTCATGTCGCTCGAGTACGGGATGCCCATTGTGCTGCCG
CCTATCGGGCCGCTAttcgccagcagcgggtCCCCCAccgccgcgctgctggcctACGAAagcgaggagcagcgcgagcagTACGAGGAGGACATGGCGC
GGTACTTCGGCGTGCCTCTGCCCAGCTGCATCCGTCGTAAAGCCACagtgacgctggaggaggaggaggccaatCTGCGCACGCCCACGTCTGTGCAGCC
CAACGGCTTCGTGTGCGGCAGCTTCccgccgtcctcgtcccCCGTCAAGAAGGACCTTTgcgccaagaccaagacgacgctgccgctgctgcagctggac
tcGCCCACGCACACGGACGGCGCGTCGTCCCCCTCCCCCTTGGGcgaagaggagaagctgcgcgtcAGTCGCGAGCGCAATCGTCTGCACGCGCAACGCA
CGCGGATTCGAAaacgcgagctgctcgagagTCTCAAAGAGCGcatcgaggcgctgcaggacgagtacgagctgctcaaACAGGCCTACGACTTCCACGC
CACGGCGGTGTGTCTGCTGAGACTGGGCAACGTCATGGACGTCCCCTGCGTGcacaagctggagcaggtgggCGTCCACTCGACGGAGGACCGAGACGAG
GACGGACAGCTCTGCGACGTGGCCAAAGCCGCGCACGACAGCGATGTTGATGCAGAGCACGAGGAGACGCAGGAACACGAGAAGAACTGCGCGTGTCTCG
CCAAGGACGCAGCAAGTGACGCCGTGTGCAATTGTGTGTTGGCCACGCAACTCAACGCGAACGGGAAGAGACCGTATGCATCcactaccaccaccaccac
caacagcaccatgCTCGTCTGCTCGAAAGAGGAGCGCGAACGCGTGCGACGCGAACGCAACCGGTTGCACGCGCGGAGAGCGCGACTTCGTAAGAAACTG
GTGCTCGAGAAAAGTCAACAGGTACGGACAGCGAGCTGTTGTTGGTTTGACTTTGTAACTTCTTGTGTTCTGACGTTAGTTTCCTGGTTGATTTGATTCA
GGCTGTGCACGACCTGCGCGAGCGCAACGATCGTCTCCGCAGTCGCCTGAGCGTTTTGGTGTCGTCAATTTACGGATCCGAGGCTTGTCTTGACGACCCC
GACGCCACGTCCTGATCATCCACTACAGGTAGGCGTTGATTCGAACGTCTCGCCTTCACCCTCGAGCGGCGGTTGGATTTTCGACGCGCATCAAGCTGAC
TGCAGTCGTCGACCGGTGCGGTCGCTCTATCTATTATTTCGCTATCTATGGGCCGGCATTTTGACCGGCTGGGGCTGCTTCAATGTAAATACAGCAGCAT
TACATTTCTTCGTTGTCATGTGGTGGTTGTGCTTCCGCTACAGTTTAAGCGTAGCAGATTTGGATATCGTGGAGAGCGCTTAGCAGACGTACGATCTACC
GCGCTGCTTTGAAGTTGTCGCTATCGAGCTCATAATTCGTCTTTGCGTTCTATCGTGTCAAAGTTTCGCAGTGCtaatgacgacgatgctaACCTGGCTG
AAGACCTGTTCATGTAGATCCGAAGTACTAGTTGTACGAGGAGGATAGAAGCACACTACTTCTATCGATAATGGATCGCCAACTCGTTTTGATTTGACTG
TATTGCAgcgctggtgaagaaggaaATGTACTTGGAACAGGTAGAAGACCAACTACGAGATGATGATAATGTCGGAGAGACCCAAGAACTGGCATCAGGT
TGTTGGTCGACGACGGTTGATAAGGTTACGTGACGAATTCTacaacgatgaagatgaagcatCAATTCGACGTGGTCGATGCAGACCTGAAAGTGCTCAA
GCAAGTCATCTCGGAATGTACCAAGCGAACGACCTGGAGTCGACGTTGTCAAGGCGAAGTCGGTGTTGTGGAGGTGAACCCTGTCCAGCTTCGAGAAATT
CGAGTTTTGGTGCTCGTTGGTCAAGATCTACCGATTCAGCATCTGCGAACGCTGAGCAAAACTCTTCTTGTCCAATGCATGCCAATCCTTTTAACTTGTC
GAACAACCAACTCGACGGTGTCGGCAGCAAAGAAATCACTAGTAGTAGATTTGCTGGCAAGGGTTTGACCAACTCGTGTTTTGGTCCTTGCAGGTGAACT
ACTGTGCTGCCCAGGTCATCAAGCATTCGATTTATCGCGAAATTTACTCGGACGCCTAACAGTTTATGCAGTGTGTGAGCGCCTCCAGTGTCGCACGAAT
CTTGGACTCTGCTACGCTGAATTATCATGCCGCTTTGTGATGAATACTGTCAAGCCAATGAACCGGTGTCATTCGCACGTATCGGCATCCCAGGTGCACA
AGTGTCCGCTGCAGCTTTGAGAATAGACGGGTATTCCACACTCACACAACGCACTGGGCATGAACGAGCGTCGAGCATCTCTCGACTTGCGTCATAATGA
AATTCGCAGCGACGTCGTTGATGCGACGGTCGAGATGTTAAATCACAACAAGGTTCTCACTTGGCTTGATCTGTCACAACTAGTTAAGTATTGGCGACAA
AGCACATATGTGGGATGCTATCGAAGAGCATCAAGCATTGCTGGGTCTGGAGCAGTTGAACAGGTAAAGCGTGCAGGAAAGAGGGCCGTGGACGTGTCGA
CTACTTGTTGTGGATCGAGCGAAGCCCAAGAGCAAATTGAGCAAGGTGCTCTGGACGAAATCCCATCGGCGATGACCACGATATCCTCGAGTCGATCAAT
GCCCCAAGACCCACAATCGAACCTGCAGCGCCAAACAATCTGCACAAGCTTAGCACGGcagtggagctggacgaagccaACCCTTTTACAACGGCGGCAG
CGGAAAAAGCATGAAAACTGGTTGATCCAGCTTGCTGTGGAAAAATGGCGGTGAGAATGGAGGTTATGATGCCGGGAAATCGTCGTTTGCTGTATGGAGA
CTGGTGGTGAGCTGCAAATGTGATGCTCGTGGAACACAATGtagaagacgaagccgcagcagcatttccatCTTGATGGAGGTGAGATCCTTTCACACGC
TGACATGCTGTGTCACACAGTTTTCTCGTGCGCACAGTATTCTGCGTTGGCGTACTGCGAAACCGGCGCCACAGTACCCCTGAATCGAtactccagcagc
agagatacttggctgctgcagatgtggAGTGAGAGCGACCACCGACATCAATTTCGCGTGTCAGCGTGGATAAGTATCCGAGAACCGTACGTTGCAGGAC
GCTGAAAACGGCCCGCGACGCTCCGTCGAACGGATTCTTTCCTTCCCCGTTCCTCGACGCTTGCGCGGACCTAAGCATAGCTCACTTCTTCGCTGGACGC
GAAGAACTCAAGGAACCATAGCGTCGCTATCTGAAGTTGACGGGGAAGGCGTGTCCACCCCGCCGCATCACCTGCCGCAGTCTgtcgaagacgaggagga
ggaggttgccCCTGTTCCGCCGAGTGGACGGACATCATCACATCGTGCTCAATCTTCAGCGGCGCCAACACCCCGGCTACAACTGGAagagaacgacgag
gacacATTGATAGCCGCCGAGGATACCCCACCAACAACCGAAGAAaactctccatcgccaacctCAAACATGCTGCCACCAGTCCAGCCTATCCGACAAA
GCAGTATGCCAAAGTTGGAGAACGTGTCCTGGGAACTGACGGCCAACATGAAGTCGATCAtcccgacgacgacgacgccgcctCCGATGCTCGGTACGTC
AGGAACCTCCCAGTCGAGCAAGCGACGCGTCACATACTCCGTTGAGGACATCAGTCCTCACGCACTCGACCGTCTCGGAGTGAACACCGACATCTtaaag
aaggagaagggaatgaagaagctggggATCTGCGACGTCGACATCGTTCGAAGCGAGGAGCTGCGCCGCTACACTGGAGTTTCCCAGCTGGAGCCGTCAT
CCAAAGTTGAATTCATGTTTGGCTTCAACGACGAGCAGTTGCACCGCGAGAGAGCTATCAAACGCCTGGGCACCACCGAGCAGGAAATCATGGATGACTA
CAGCCGTCGAGTCTCCCGCTTGGGCATCTCGAACACGTTCCCTGTAGAACCATAACATTCAGGGACCTTTTGCATCCTGCTTCACATACCAAAACCAATT
CATTTTATCGACCCAATGTTCACTCGTACCTCACTCATGGCGTCCGAGACGTTCACATGTACTGGTAGCTGTTCTTGTCCTTTTCCAGCTGATCCAGCTT
GTTGCCGAGAGAGATCCCGTCGCTTACtgcgccaccgccaacgtTGCTGCCAGACCCACCTGTGTTGACTCCACTGGGGAGATTTGCCACAGCGTTGCTC
CCTGACAATGAAAAGGGCGGAGGGTACCCGCTAGTTGAACCACTTGGTCTCAACTGGGCGGAAGAGAATGAACGGTACGTCGATCCACCCATGGTAGAAG
ACACCGAGAAGCTGTGCTGTGAACTCTGCGATCCGATCGAcacctgctgttgctgctgtttgtccATGAATGATTTCTTCGCACTACGCATCGGTGCCtt
cgcctcctgcttctgtTGTTgatattgttgctgctgctgctgtttcttcttccccttTGACACCGCACGTTGGGTGgccaatgctgcagcgctcgctcgc
tgTTGCTCGATAATTGCAGTTTGATTGTTGTCACCCACGATCGGCAAGTCTAAATGCTGGCACTGGCAGTTGCAGTCCGTGACGGGGCATATTGTGTGCG
CTTTAAACCAGTCTGCCAAGTGGTGTGCATGACCGCCATGCTTGCAGGACTGGCACCAGGTGAACCACTCCACGAACGGAATACTTGACAATTGAGCTAG
GTTCTCGTACTCGTTTTTGCCCGTTTTGGGCTCCTTCAATACACCCCCATTGTCCGCCGCGACACTGCTCACCAACGTGTTCACTGCATCCGACGTTTGT
CTTGAGCGGCGGTGAGCCAACTCGAAGTAAGGGTTGAGTGATCCGAAGGGAAGCAAACACAGCGCACATTGCGGAAGTGGCTTTCGGCATGTAGGACAGC
ACGTAAGCTTTGGTTTAGCACGGTTCAACCACGACGAGTGCGAGCCACCAAGGCGAAGCAAGCTAGCCAAAGACAGCGAAGCATTGCAAAAATTGCACCG
CACAAACAATTGTGGTGGGACGGAGAGTGTCGATGGAGCCGAGAGTTCGGCTTGAAGATCTTCTGCATCAAAGTCGCGcgagaagctgacgaagcCGTTG
AGGAGATCTTCAAGTTGCGAGCGACCCACATCGAAGCGGGCTCGCTCGTGGAAGAGTTGCCACTGGTTGAGCAAATCCTTATAAATCTGAATCCAATTCT
CCAGCGGAGGTGACTTCGCAACGTAGGAAGATGGTAGACGAGCTACCAATAGCGCTAGCGTCTGGATATCGCCTGTCATATCCAAGTATGTCTGCAGAAG
CCGGATACCGTCAGCATTGACGCCGGTCACAATTAATCCTTCTAGTCGCCCAAATTGCTCGCTCTCCTCTTCATGTTGAGCAACaaacgcaagcagctca
tcggCTTGGAGATATCGACAAGCAAAACCAAGCCGGTCACTTAACGGCAGTGTGATATCGTTGAGAATCGCCGAGTATGCGCCAGCACTCGCAGCTCTAG
CTCCATTGAAAGCCGCCAAGCCGTCCACACTCCCCCACTGCCTCCGGCTATTCGCACGCCGCGGCGGCTGTTGGTTTGCCCGCATGGCATTCATATTCGC
TGTGTTTGAAGAAGATGTCGTGCTTGCGGCacacaagaaggagagcaTCGCGTGGAAATAGCGCGGGTTGGCTTGTGACATGATTTCACTGCGCTTCAAT
AATTGCTGAGTCATGTCTGACCATAGTGAGAACCCTCCCGCACTTGCAATTGATGACGAATAACCAGCAACCGACATCgcgatgagctgcagcaaatcCG
GCGAATACGGCGACGAGACACCAACATTCAAGTGCTGCATTTGAGTAAGCCACGTTGCTCCTTTTTGTAGCAACGCCACAGCTGCGTTCAAGTCTCCATG
AAAAACTGCCAGGGCTGCTCCTCGAGCGTAGTTGCCTTCCAGCTCGCATCGGTTCAGGATATTCTGTAACTCGTGGCGTCCATTCTCATTCCACGAGCGG
TTCGCGAAATGGGCATTATCATCGTACTGCTTCTGCGGGTTCCAGATACTCGAACTGCTCCGATGGATGTTTCTCCCCGCGGCACTATCAAGACCCGGTC
CACCCACGCCTGCTGGCGATGCACGCCCCCCCCCCTGTCCATTGTCAGGGTCCCAGTTGCATGCTAGCAAACCCAATCTGCGCCCGGGTCCTTCAAAGTA
CTGGCAACCAAGGACTTGATCGCACTTCATCACAGATACGACAGTAACAAcaggttcttcttctctggAATCCTCTTGGACAGTGGCAGCAGGACCAGAA
GAACCCGGTCTTGCTGCCGCTAACGGATCCGCTGAGGCCATCAGCAAATTCTTCACACCAGCAATCACAAGTGTATGTGGGTCAACTGGCCACCCGCGCA
ATGGTCCACTCATTGCAGCATTTACAGCATTGTTCCCGAGGCCATTACTCGTAGAACGTGACTGCTCTACCCGTGAAGCTCGGGTCCGGCGAAGCGCCTC
CACTTGATCGACCCATAGCCACAAATTGCGTAATTGGCGGCCACGTGGTGTAGACTCATTAAACAACTTCAAATTCTTCGAAAGTCCAATTGAGTAACCC
TGCTTGGCAAGTTTGTACATTTCATTTGAAATGTCTTCTTCCACGCGACTGCCAGTGTTGATTTCCTCCTCTAGCGCCAATCGAGTCACAGCTGATGTTC
CCAATCCAGGTCCACTAATCGAACCGCCGAACAAGAGCCTTCCGCAGCCAAAGGTTACAGCACCATGAGTCGACAGTGAGAGCGGCATCGCGTCATGCAC
CGAAATGTCTCCCAGTTCACCAGTTACTGATGCCGTCAGCAGCCGGTTCGggaacgctgctgctgcaagctgATGTTTCTGtgcgttgctgcttttgcCC
GCATTCGTTGCGCGCTGCACTCGCGATGGCGAGTCCACATGTTGCCACGAGAAAGATGTCAGCGGTTCAGACGTATACCGTCTACGGAATggcttcttga
gcgtggaGGATCcgctctcctgcttcgtcacATCCCACAACGATACCCATTTTTCCTCCGTAGACGCCGTCACCAGAATACCCGGCTTGGACGGACACCA
CGACACCTGCGATAAATTCTTGCTAGTTTGAtacaacgacagcagcggccCTGACGACGACTCCAGTTGACGGATATCCCACACCTTGACCGGTTCTTGC
GGTGCGTCACTGTACGTCGCCAGCATATGCGGCCGATGCTGATCAAAAACCACCCCCATCACCGCCTTATTGTGCGCCACCACACTCATAGGTGACGATC
CTTTGGCACGCAGATCATAGACCCTTAGCCACTTGAACCCCGTCCCTGTTGCCAAGCACGTCGGCTGCAACGGTACCCACGACAAAGCCATCGTGGCTTC
GGAATTGGCCAATTCATACACCGGTTTCGAATCTGCAGCGGAGAATCCGTTGCCTCCCGCCCCCGCACTGGCACTAGATCCGCCATTGCTGCCTCCTTTT
CTGCCATTCAAAGAGCGTTCTAAACCTCCGTCTTGATCCACCAACCCCTCAATGTTGCCACTACTGGCACTGCTCGTCATCCCCGGACCCCCTCCCGCTC
CCCCCACTGCGTTGGACGTGTTAAGATCCCAGACCAACGTGCAGAAGTCACTCCGAACCTTCTCGAAGCCTGCAGCCAATTGGTTGGGCACCGACGGGTT
CCAGGCCACCGCATGACACGGCCGACTGTATTTGGGCTGGAACTCCCGCATGACGCGCGCGCGCGGGTCCTCGAAGTCGCACAGAAGCACTTTACCCGAC
CCCGTGCCTGCGGCGATCAGCAGCGGCTTGGCTTCGAACGGATACCACTGCAGACACTTGAGCTGGGACACTTTGGCGTTGATGCGCACCACGCGGAAGG
CGCGTTTGCGCTGCGTCGTGGGGGCTGCAGGCTCcggcgctgcgtctgcataTTCACTGGGGGCTAGAGACGACGTAGTGACCTCGAACAGCCGCAGGTT
GTCGGCCCCCACGGCGAAGAGGGACGCGTCGTGCGGCGACCACTCCACCACTGTGCGCTTGCTCATGTTCGATGGCAAAAAGTGGAGTGGCGGATATTGG
AGACGAAGGATTGGTTGAAAAGGGATAAGAGGATATTGACCAATGAAGTAGAAGGTACGtgaacttcaacttgagatggctacattttaGTTGCACGTCT
AGTGGCTGACACCTTCGTACGCGGCGATCTGAGCGATGAGGTCTTGGTATACGCACTCGTTGGCGTTATAGGCCCAGATGAAGTCGAGGTGGCTGTAGAT
GTCGATGGTTTGGTCGTGAACGACGGTCCCTGGCGGCAATGAGGAGCGGAGACGATCGAGGTCGGCGGATTCGGTCAAAgtgtctccagcgccgacgtaG
AGTCCTGTGCGAGGGTACACCATGTCGCTGAGAGAGAACGCTGGTGGGTCGAAGGAGCCGTACTTGGCCTTGTTCTTGCAGATCGCCGACGAGCAGAGTG
CGAGGCCCAGCGCCTGCACGCAGCTGCATCCGTAGTCATAACGAGCAAAAGTGTCTGCACGAATCCCCTGGGCGAAGTGAGCGACGTCCTTCACCGAAGT
ACCAGCGGGCGTCTGTGAAATTAACACAGGGACGTGCGAGATGTTGAGGCTTGTGGTTGTTCCGAACAACAGCGAGATGGCGGACCCGCAGATCGCGTCG
ATGGCTGTGCACGCGTATCCGGCGAGGAACTTCGTGAGCAAGTCGTTGTGCGGGAGGAACTTTACGATGCCCAGCCCTTGATACAGCAGGTCGAGGTGGG
CGTCAGCTAAAGCCACGAACAGCTCTGCTTTCGAGTGTCCAAGCCAAGAGACGGGGGCGAGTGCACCAAAGTACGACACACTCTTTGCCAGCGTTTGGTT
CGCAGCGAACCCGACCAGCGCCTGGGTGACACCCTGCGAGTGACCGATGTAGCTGATTGTCGAGCGCCCTGACGTGTCTTGAATGTAGTTGATCACTGCC
GGCAGGTCGTACAGCCCCATGTCCTCCCACGAAAAGTCCCAGAACTGGTCGTCATCAGTGGTATAGTACAGCGACTCGTTCGAGTACGTGTTGCCTCGAC
TGTTGCCAAGCCAGACATCGTATCCAGCATCGACCAAAATAAAGGCCAAACTCTGGTTGCGGTAGTTGCAGACCCAAGCAAAACTGGATTCAACCACTCC
GTGTTGTAACAGCACTGCGGGTTTGTTGGTCGCGCCGTTAGCGCCCGCTTGACTCTCGTCGTAGCTTTTTGGTAGGCGATGCAACGTGAGGATATAGCCG
TCTGAGGTCGTGACCTTGTGTGTCTCTACGTCGTATCCGCGTGCAGCGATAATCTCCGGTGTATTCTTGCCCACATCTGGATCAACATTGATCTCTGCGA
CCTCTGCAACCTGGTTAGACGCAGCCACGAACCCGATGCTCACGAGGAGCAGTAAACCCCACGCTTGCAGATGCCACACGACCATGACCGTACTTCGGAA
GATGCTTGGTTGTGTATTGCCTTGGCAATAGAGCGCAGATTGCGGAATGAAACTTTGAAAACGCTGCACAATTACCCGTGGAGTAACGAGAAGCCCACCT
GACAAGGGAGCCGCAGCGGCAAGTACTTTCCCGAGTGCTACGTCAGTCACAGCCCCTCTGGTGTTGCTCGACTGGCCCAACTCAATTGACAAAACCTGCG
CTTGACGGCAGCGAACCACATCTTGACGAGGGCAAAGTGGTCAAGCACCAAGGTTACTAACTGCACCACCAACCTGATCCGTGTTGCTACCGTCCCACTC
TGGTGCACTGCGTCGCTGAGGCGGACGCTTGCTCTACAAGTCTAAAACTTGAAGTCTCGCGTAACATCGAAGACCGACGTCGGAATGGCATTCATGtata
gcagcagcagcgtcatgagcTCCAGACTGGTCTCTTTGTCGTCGATCGTCTCTGCTCCGAGTTCATTGTCGCCGCCTTCGTGATCATCTCGCACTGTGCA
GGATTCAAGCTGCATGCAGCTAATAGATCGGCACTGCAGCCGTCGTTGCACGGGGCACGCTGCCTCAGGTGCCGCTGGTGTTCAGTGCGACTGACGTGGC
GAGTccgagatggctacagtttCGACTGATTTGCCTGTCTCTCCTCCGATTGGTTGGCCGATTTCTGCCAATCGCGACGCGTACAGGCTTTTACCGCGGG
CGCCTCCACCACACTCATTTCCGCCCCGACGTCGCGAGAGAAAGCCAGCCGAAGCAGCTTCGCGttccgtctccaccacacacacacagccCCAGCACCA
TGGACGACGTCTCTctcaagcagaagcagacggACGACAAGGACCTGGACAACCTCATCTTCAACGGCGAGAAGGAGGGGGAGACCGTCGCCAAGGAGAA
CCAGAAGCCGCAGACCCACGACGGCGCAgactcggacagcgacgagaagacgtCGGCCAAGGCCGGCGACCGCACCTCGAGCGTCAGCAACGTGCTGCCc
gtggacaagctcaagaacggcGCCAACACGGCCTCCAAGTGCGTGCTGCCGTCCCAAATCTCATCCTTTGTTGCGCTAATTGAGTCTTTTTGCTGCCTTT
TAGGGTGCTGGGGCAGACGTTCTCCATGTTCAAGGAGAAGTCCGGAGCAGCTTATGAAGCAGCCAAGTCCTCGAATGCCGGCAAGACCATTGCAGGCGGA
CTCAGCTCTGCGGCCACTGCCAGTCAGGAGCAGTACGGCAAGCTaaaggagacggaggcgttTAAAAAGTCGTCCACACTCGCCAGTGGCGCCTATGAGC
GGACGTCTCTTGTCGCATCGGGAGCCTTGGAGAAGGTGCGTGCCAGGGTGTTGATTGTAGCTTGACTTGTTGAGGAGGAATGCTGACGTGCGTGATTGTT
TATGGCTCTCTTTGTTTTGCAGGCGCGTTCTGCTTCCTCAACGGGTCTGGAGATGGCTAAGCACACTGCTGCGGCGGGTATTGAGACGATCAAGTCCAAG
AcgggaggagctggcggcaagaagggcgagaaCTAAGGCTGCACCAACGTCGGTTTTCGTTTCTCAAGCCCATCGACGCGATCGACGAATGTTGGGATCC
GACAAAACAGCTTGGTCTCCGTTGACTCATCGCAGACGGCGCTCGACGGGCTTGGGATGTGTTTATCTGCCCTCTCTTCCTCTTTCTCTTCCACCATTGC
ATTTAAGCGTTGTTGCGTACTCGACTGCAGTTAAAGAGACAACAATACAGATAGTCCATTTAGACCCCACAGCTGAGGCGATCGACTAAGGCGTCGGTCC
TTGCAATAATACCGCCCAATAATGTACCCATTTCTGAGGTACAGAACTGCATCCGAGCAACTTCAAAGATACGAAGAAGCAACAGTGATGAGCctcgctg
ctgagctcgagCGCACCACGCGGGACCTGGCAGCGCTCTGTCGACGGAGCTTCGGACCTTGTGGGGAGGAGACGTTGCTGTTCCGACCTCCTGACGCCCC
GGTAGTCACGGGCGAGGGCCACGCTGTCCTCGCGGCCTGGAAGAGAGGGCTTGGCGCAGATGATCCACTGGCCAAGTTCCTGCTCACAGCAGCCAATGGA
GTTCACCAGCAATTGGGCGACGGATCCACTGAGTTTATTCTTCTGGTGGACGCTGCGGTGAGGTATGCAGACGAGAGTCTGAATAGAAGACAAGACGCGC
AATACTCAGCCGATCGCGCACGCTTGTCGAGAGCTTGTGGCGAGCTGAAATGGGAGTTGCAACGAGAAATTCAGACTCCGCAGTCGTTCTTGGCCGGGCT
GCAAGTTGCCGTACCAATTGAATTGGAtacgacgacgatgcagccaTCGATACAGGTACGCAGAATGCCTTTGGCTGATGGCGATTGTGCTTTGGTGCTG
ATGATGCGTTCCTATGCTGATGGAATGGCTAGTTTCGAGAGGCGAGCGCTAACATTTTGGTATCCGCGCTACGTGGCATGCTGGGTGAACGCGCAGTGGA
TTTTGTGGCTGAGTTAGTGCTGAATTGGGCATTTACTTCCATGACACATGCTGCTGGTACGGAGAGGACGGACGAGTTGTTGTTTCGGCGAGTGGGGCAA
TTTCTGAAATGCGCGCCAGATGCGGTAATTTTCGTGGCCGCGCCGTCGGTGTATGCATCGTGCGTAGTGCCACTTGACGAATTTATCCTGAAGAAGTCGG
TGGTAACGTCACAACCTCCGGAGATTTTAGATCGTTGTAAGGGGCCAGTGCGATTTGTGTGCTTCACGTGCCCACCGTTGTTGTCTGCAGGATCCAATCA
CATCGAGCTGGCAACGAATAGTGACGAGGAATTGTTTACAGCCCAAGATGCAGCGTATCTATTTATCTCCAAGTTTGTGCGTCGCCTTCGCGATCTTTTT
CAGGTTCAGCTTGTCGTCTGCGCGGAAGCTCTCGACGAAAGCGTGATCTCAATCTGTACTCGACAAGATATCGCATGTGTACAACTTGTAGAGTCTGAAG
ATATGGAAGCACTGTGTATGAGTGCTGGAATATTTTCCCTCGCCAGTGCTTTCGATGATATACGACCAACAGAACATATCGGAGTCAGTGCGGATGGAGT
CTCTCGAGTGAGATTCCAACAGCAAGCGTGTTTACGACTGCGTGGGCTCTCAAAACGGAAGAATCCATGCGGGAAAAAACGGCAGACCGAACAGCGGCGG
CAGGACATTGTGGTTCCTCAGCTCCTGGTGTATGCGCCAACGAAAGCGGTCTACAAGCAGTATTATGCGGCAATCGTGAAGTGCCTACGAGTGCTTAAAA
GTTGGTGGGAACCGATGCCATCTCAGACTGATTATCTACAACGCTCTCAACAACTTCTCTATAGTTGCAGAGGTGGCGGGGCTACCGAGCTAGTGATTGC
ACGCTGGCtgcaaggaggaggcgaaCAATTATCTAGCGACGTTGCATCACGCGATACACCCATGCTTTATCTGGCAAGAGAGATTCTTGCCAACGCCCTC
ATCGACGTTGTTAGCATCCTGCAGAGCAATTTGACCAGCGGCGAAGGTCCTAACTCCAACCACCGTGTTGGTAACCAGAGGCAGGTTCTTCTCGACACTT
TCAGCAAACTGAACCTCAAGGATACACCCGACCAACAGCAGGAGTTCCAAAGTTACACACTTGACTATTCACGCGTCATCCAGACACTAGCAGGCACGAT
ACAGATCCCGGAACTTGTAGTCGGCGACCCAGCTATTCATGGGCTCGTGCATCCGTGGAGACGAATTGACTCACTActcttcctggtgctgcagacACTA
GAGCAACTCTTCCGAATCGACAAGATCGTTGCCagacctgcagctgctgtaAGTTAAACAAAATCGAGTactgctccaccaccaactctTTCGACCAGTA
TTAATTAGCAGGGCAGAATTTAAAGGCGCTCTTTTACGCCGAGGAGCGCAAAATACCCAGCGAAGCTGTCGTCCACGTGGATCACATTAGGGACCGAGGG
CGCTACTGCATCCTCAGGCGAGGTCGGGATGTGCACAATGCGAGGAACATGCTTCTCCAGATCacgaacgacagcagcatcaactgcACTCACCAGAACA
CACATGGAACCATCAGTAACCTCTCCAATAGCACCACAAAGCTCAGATATCCGCACCTTCCACATGAACCTGCGGTTCAATCTGTCGTACGAATGCCACC
TTGCCAATTGCCGTCGTGCAGAAGAGAATCTTGTGCGCCTTCACGCCCTTCAAGTCCGGATGGGTCGACACAAACTCCCTTATACGCTGCATGGTCTTCG
TATCGTTGGTGTCCTTCACCGTGCACAACAGATACACATCTGCAACGTGCGATAGATCCGCTAGCAGCGTCGGCACCTCGTCGTTCGTCCAGGTCAACGA
GTCCGGATTGCTCGTCTGCAGTAGCGCATCTCCGCTGATTGTGACTGTACGCACGCCGTTCCGCATGGGCAACGTGAAGTGGAAACGCAGCTGACGGTCG
TTCAGTCCTGCAGTGTTGATGGCGGAGCGTCCTGGAGCTGAggcagcagtcgacgccgttcgaGGCACGTTGGTCGGCGCATTGCCGCGCTGTGGAGCGT
CCCCctggcgcagctgctgcacgtacacGTAGCCGGTGCTGATCATGACCACCAGGAGGATGATGAGGATGCCCAGCAGACTGTCGTCGATCATGCCGTC
CACCACTTCGGGGCTCTTGGCGCTCATGGCGATCTCTGTAGCTACTCCAGCTCTCAAAAATGAATGCTACACGTGTTTCACACACAATGTTGGAGTGTTC
TACCTGAATGTTGAATATTGGTGTTTTGCACACCATACTTGAAATTACgaggccaagatgaaggaggtggcggatggctgcttccagcagctctacgGCG
AGATCGTGCGCTCCATGGTGCGTATTTCTCTACAGCGAATTGCTTTGCATGTATACTGAAGTGTTGCCTACAGCTGGAGCGGTATCCGTGGCAAGCGGAA
GGCTCGGGGGACGCCACGACGCCCAGtgcggaggaggaggcggcgcaTCGTGAGGCCGTCATCATCAAACTGGAGGCCATGGGCTACGACGTGGGCTGCC
GCTTCGCCGAGCGCGCAGCCAGAGACAGGCCGCGTATGTTGGAGCCGCTGGACGTGATCAAGTTCGTGTGCAAGGACTTCTGGATCGCCAtcttcaagaa
gcagatcgacaagctgcagacgaacCACCGAGGCGTCTTCGTGGTGCAGGACTTCAGCTTCCGCTGGCTGGCGGGGATTTCTGCTGCCACGGAGCAGGAG
ACGAgggagatggcgctgctgttcttggtTTTCCCCTGTGGACTCATCCGAGGAGCTCTAGCCAACCTCGGACTCACGGCTATCGTCAATGCGGACGTCC
CGGACGTTCGCTCGCTTCCTGGATGTACGTGGTGATAGTAGAGGTGCTGGGTGAAGCGAGAGGTAGCTGatgatgttgtggtggtggtgtgcgCTTGACG
TATGGACAGGTTTATTTAACATTAAGATTAAGCAGGGGTGACAAATTCAAGAGTGACGCTCGCTTTCTGAGACGCTGAGCAGCACCTTACCTTGCCTGTT
TAAAGCATGTCACCCTCACTATTTTGTTCTCAGTTGTCTCCACTGCCGCTGAGCAACGACTGCTTGCCAAAGGtctcgatgaactcgtccagttcgtccG
AGTGGCCTCCACGAGCACGACCCCTCGGCAAATGATCCGGACGATAGAAGTCGATGATGAGCACGAGGCGCGTTTTGTCTGGGTGGTGGTTGAACGCGTA
ATGCAGCTTGCTGTCGTCGAACACAATGAATTCGCGCTCAGCGTGGAAGTTGGTCTCACCGCCGACGACCATGGCGCAGCATGGTTCTCCATCTGACAGC
TTAGGCACGACGAGCGGGAAGTGCACGCGGAGAACGTGGTTGGCCAGGTCCGCCCACCCTCGATGCGCAGTAAGCGTCGTGTTGGGACCGAGCTTAGAAA
ACAGCGCGGTGCGAATGCCCGGCAGACCCTTGAGGATTTCAGCCGTGCGTGGGCACATTGAACAGGTGGGGGATACCCACGTCGTCTTGGTTTCGTCGTA
GGCCGGGAACGTGTAGCAAAACGGAAACACACGCCACTCGCTGTCGCCTTCCGTGTAGTGTTTCTCCGGCCAGAACGGCCACGTCGCCATTTGCTGCACT
gcctgcatctcctccaaaATCACATTATAGTTGTCCTTCAAAATGTCGAGTTGGGGGAACAACTCCTGGTACGGATAGTAGCTCGGCACATCGTCATCTT
GGATCTCCTCATCCGAACAGTATCCCGCGCCGTCGCCAACCCACTCAGTCACATTACGAAtatcttcctcttcatcagtGCTGCATTCATCCGTCTTGCG
AAGACACAGCAAGCGATATCCCATCTGGTCACGACGCAACAACTCGTAGAGCGGCGAGTGCTCGACGAAGAAAAAGGTCTCGAGCTCAGAATGGAACTCC
TGTGGTGTGAACTGATGGATTAGCTCCTGTATATTGCCCGAGCTGAGCTTGGCTCCCATTGCCGCTTCGTATGACACCAACTGCTCTTGCACGATATCGA
ACTGCGGGGCTTTGTTCTGAGCCGACGAAATGGGTGATAACAGCGAGTGCTCCAAGTGATCCGCTGCTACATCCGGCGGAATAAAGTCcgcgacgaagag
cagccCCCCGGGCTTGAGCACACGTGAGATCTCGTTCACTGCTTTGCCGAGATTCTGCACTTCCTGCAAACTCTGCACAGCGACAGCCACATCAACTGAA
TGGGTCAGCAGCCCCTTCATCCTCTCGCACGAGTGATGATACAGTCGCAGCTTCCGCTCCTGGAACTCTGGCATCTGCTCCGTAAAGCGGTTCCACACCT
CTTTACTGCGTTCCAGAGCTTGGATCGAGCTGTCCAGCCCTACAACCTCCGCCTTGGGGTacagcgtctgcagttcACACAACCCACCGCCAGCTCCGCA
GCCCAAATCCAGAATCGTGAACGCCTCGTCACGTCTCGCGTCGTGGCCCGCGTCGACGTCCATTAGGTTGTCGTAGAGCTGCAATTGGAACCTGTCGGTC
GGGTAGTGCGCCTGGAACTTGGTGACTGGTGGCGTATCTCCAGAGCCCACGTTCCCATGGGCGACGGCTGCTAcggctgctgcactcgagtTCACGTGCG
TCTCTCCTCGCGGATGGAAGCCGACGTTGCAGCACACGCGGTGGTGGTCGGCGTAGATGGGCGAGTGGAAGATGCCGTCGTAGAACTCCCTCACGCTGGG
GCCGCAGCCCTCACTGCCGCGTTCGCCCGGCGCCATACCTCACTCTTCGTGGCTGTCTTGTCGCCAAATGACGGCTTCAAGCTCCAAACGGTGATGATAT
CGTGGTGCTCGAGCGCGTTTATGTAACTACTGGAAGAAATTCACAGCAATGCGGTTTTATTCAGTACATttgtgcaccacaccatgCTTTTGGCAAAATT
GGATGATAACACGCAGCAAAATAAATGTCTGACGAGGAGCTCTCGCCGCACTCTGCGGCCAATGAGGACGACGCTCCTGGCGCCGAGAACGAGTACGGAC
TGCAGGATCTAGCGCGTctgccactgctggagcaggtcCATCGTCTTTTCCACGCCATCCAGCACAAATATCCATACAAAGAGGTATAAACCCCACTCTC
CATCCAGTAAAATACATCCTCCTGTGTACTAAACTCTCTCtgcggttgttgctgctgcagaccaacGCGTGGAAGAATCTGCCactggagcagaagaaga
agatgctgaatTATATCCGAGACAAGCGACAACGCAAGCAGCCGACAGATGCAGAGGCCAAGACTGAGGCGAAAGGAGTCGAGGAAGCTAAATCTGAAGA
CGCGGAGCTGCCTGTGGACCCAGCGATGGCTGTCAAGTCCGATCCTTAtctgaagatgctgcagcaaagaaGTTTACGCTCAGCAGGTCCCGTGGTGGCT
GGAGAAGATAGAACTGCACTTCCCAAGCACCCGAACAGTGCTTACGTTGCTCCAGCACAGGTGCCACACTATGCGCAGGTGAAGCCCAAGTACAGGCCTC
GCTGGCAAGTGGCAGAAGGAGAATTCTTTGAGGAGGTTTGTGCATGTGGGGTGAAGCACAACACGGCCAAGAaaggcaagaaggcggcctTGATGCTGCA
CACAATCAGCTCCATGATGAGCACGTTTGGTGACAGTACGCAGTCGTGCGTGACTGCTGTTGAAGAGGTGCAGGCGTTGAGTGAGTCGTTGATGTGAAGA
GTAGTGGTAAGGCTGCAGTACTGACGTGGTGATGGTGTTTGTGTGGTGTAGTTGGCGACCACATGCGGAAGGTGTTAGGCTCGGTGAATCCAGAAGTGCT
AACAGCATCGTCGTGCCTCAGGGTAAGGCTCACCAGCGTTGTGTATGTGTGAGGCTACTAGCTTGCTTATGCTCTTGTCATAGACCTTAGTAGAAATCTT
CGAGGAAGAGGCAATATACTATGGGCGCTGGCGAGAGTTCCGCGGCGAGACGAAgcacgaggagaacgagcttGAAgatgtggaggaagaggagctcGCG
GAGGAACTGGATCTCTTTGCTGTGTCTGAGACTGAGGACGTGTTCAACGAGGCGTTTCTGGTGCGACGGTCGAACCGTGAAGTGCTATTATGCGCGACTA
ACTGTGTAGTGGTTTATCGTGGTATGTGCAGGAGCGGATACGGTTCGCCGACGAGCGtacgaagacgatggactGGTCTATCTACGACATGTTTGCAAGG
GGCCGCAAGCTAAATTTCATGAACAACAAGGCGCAACAGTTCCGACAATGGTTAAACCTCGGAAAGATGTCGCGTGCATCTCTCGAGTTCCTCAACTTCG
TCACTTACCACAAGTACGTTTCTAACTACACGGTCCCTATCGCACCCTGCTCACCAGCTATCCTAACTCTATCGTGATCGTCCTTGTTCCAGCATTGGTC
GGTTAGTGGAGTTGGCAATCAAGAACCGGACAGGTGGAGAGCTCAAGCAACTGGAGAATCCCTTGTTAAAGGATGACATCGAGTACGTGTTGTTATACCC
TTGGCTTTGTTCCGCATTGAAGTCTCTGAACCATATCGATATTGTGGGTGCATCAGGTCTGTGGCGCTTACGTTCCTCCCAGCGCAACCGCTCCCCAAGC
TTATCGACCGACCACCTGCTGCGAAAACTCGTCGAGTTGGTGTCAATGCCTCTAACAGCAAAAGTGTCCGCGTGGAACCCAAGTCGCGGATAACCACCGA
GGCTACAGCctcaacaccagcaacaataGCGACTTCAAGCGGGAAACCCGAATCGGTAGCGAGTGTCAACCCAACAGTGACTCCGTCAATCGTCAGTGCC
CGACCAACAAGACTCAAGAGGTTGCGATAAACACAGCAGTGGCTCAGTCGAACAGGAAAAGGCAAAGAGGAAACAGGTACTTCCTGCATCCAGCGATACG
TGTACTCGAACTGTTGAGCTACAAACAGAAATgcatcaccaccatgacAACTTTTCGTCGCGTTTTTGAACGATTTTTTTGTAGGACAAATCAGTTGGGA
AAGAGAAGAACCGAAggaggaacaagaagaagagctcatgGTCATGGTCTCCACACGGACGTCACTGTTGACCAGCGTCAACGTGATGTGGCGCGAGCGT
CAGGAAGCGTTAGGGTTCCTCCCGCATGTAGCTGCACTCATTTCGGCGTTTTTAGATAGCTCCGGGCCACTATCCATGACGAGCTCCACGTACTCgtcag
cagaagctgcagcggctgctaCAGCTGCGCTTCAAGCCACCACCGGTTTCCACGAGATGGAGCACTCGATCAGCGAGCAAGGAGCTTTGTTGCGTTCGCT
TCAAAATGAGTACGCCAAGATGAGCATGAACAGAACTCCACAGCGATCACAGTCCAATCCGAGTTTCAACCAGATGCGCGAAAACCGCTTAGCCGAATGG
CAGGCTGCCGAACGTACGCAACCCATTCCCAATCAGTATGACATTGATATCGACGACTaaagcatcgtcgtcgtgaGACTTTACACAAGTGAGTGAACAC
AGTAAGTAGTTAACATGGCTCAGAGCCCACCTATATAAATTTGACGGGCTCCCATTGACCATAGCTTGAGCCAGCATCAAACACTCTATGAAGCACGCCG
CCAGGCCCAAAATGAGGTTGCAAGGAAATCGAGCTCCTACGAAGGAAGCTTCAGTGATCTCCCATGCAACGAGTATCATCATCCAAAATCAAGTATGAAC
GCTGTAGgccacgttgaagtcgaTTCCAAGCGCATCCAGACGCTCTCGATCTCTTTCTACATACGAGGTGTATGCCCCCGA