Description :
From Genome Similarity Track
Location :
Scaffold_286:673- 1766
Transcript NameFunction/comments
Phymu_g8076hypothetical protein PHYSODRAFT_258180

Sequence
1093 bases(100 bases per row)
GGGTGCAGACCAAGGAAGCCAGGACTGGGCTCTCCCTGCACTTCGCCAAAGTACAGAGCGAACGtctgcttccactgctccacCTTCGCGCGGTCCTCCA
TGAACGATGGGAAGAACGCCATGTTGGCCTCCGGAACGTCCCAAGGTTTGTTAGCGTTGATGTCCGTGCGCACACTGTTGAACACCACCGTCGTCTGGGC
TTCCTGAGAAATAGCCCAGTTCATGAACAGCTTGGCGGCAGCAGGATGCTTGGCCTTTTTCAAAATACCGACACGTTGACCCCAGCTCAGGTAGTCCGTG
CCATTTCCTCCCACGAACTCAATCGGAGCGCTGCCACCACTCGTGCCCACGCCGATCAGCTTCTCCCCAGAGCTGACAAGTTCACCCGCGACATTCGAAC
CACGGTTGAAGCTGACGTTCTGCTGAGCGAGGCCAGACACCCAGTCCCACccgtacttctccacgtaGCGAGTGTACAGGAACAGAacggcgtcgtcatc
gtGAGGGTACGACGAAGCAATTTTACCAGCATATTCCGGTTTCACCAGATCTGCCGGGGTGGCTGGTGGCGTTAGTCCGTCGAGGGCAGTCGTGTTGTAG
ATGTAGCCGAACGTGAAGATGGTGTACGCCAGCCACGCGCCATTCTTGTCCTTCAACGAGTTGTGGAccttggagaagttggcAGGTTTGTACGGCAGGA
GATCGCCAGCCTTAGCCCAACGGGTGAAGTCCTGCAGTGTCTGGAGCGCCACCACGTCGGGGACCAGTGTATCGGTCTCCAACTGGTTGTCGATACGCAC
GTCGTGGTacttgctgtagtcgacGACAACAGTAAAGTTGATCTTGGGGAAGCGCTGTGAGAATGCGTCGTGCAGACCGTTTTGTTGCGTTGGGGTGTCA
CCTCCGTGGTAGAGGACGAGGTTACCCCCTTCTGCCACGGCGTCAGCGTAGAGTTGGTCGATGGTCTTGGTCTCCTCCCAAGATTTGGCTACGACTCCAG
AGGAGAAGATAGCGCAAACAAACAGAAGCGGAGCGAAGAGCTGCATGGTTTGTAGTCGGCAACTTGGGCAGGAGAACGGAAGTTGTAGAATGA